ID: 913182160

View in Genome Browser
Species Human (GRCh38)
Location 1:116332812-116332834
Sequence GCACATCACCAAAGGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913182160_913182164 -9 Left 913182160 1:116332812-116332834 CCAAGCTTCCTTTGGTGATGTGC No data
Right 913182164 1:116332826-116332848 GTGATGTGCATAGGCAGATAGGG No data
913182160_913182166 20 Left 913182160 1:116332812-116332834 CCAAGCTTCCTTTGGTGATGTGC No data
Right 913182166 1:116332855-116332877 ATCACCTTATCTCAAGGTTTAGG No data
913182160_913182163 -10 Left 913182160 1:116332812-116332834 CCAAGCTTCCTTTGGTGATGTGC No data
Right 913182163 1:116332825-116332847 GGTGATGTGCATAGGCAGATAGG No data
913182160_913182165 14 Left 913182160 1:116332812-116332834 CCAAGCTTCCTTTGGTGATGTGC No data
Right 913182165 1:116332849-116332871 TTGAGAATCACCTTATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913182160 Original CRISPR GCACATCACCAAAGGAAGCT TGG (reversed) Intergenic
No off target data available for this crispr