ID: 913182163

View in Genome Browser
Species Human (GRCh38)
Location 1:116332825-116332847
Sequence GGTGATGTGCATAGGCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913182158_913182163 8 Left 913182158 1:116332794-116332816 CCAGAGCACTGGTGTTTTCCAAG No data
Right 913182163 1:116332825-116332847 GGTGATGTGCATAGGCAGATAGG No data
913182156_913182163 20 Left 913182156 1:116332782-116332804 CCTGGGGTGGGTCCAGAGCACTG No data
Right 913182163 1:116332825-116332847 GGTGATGTGCATAGGCAGATAGG No data
913182160_913182163 -10 Left 913182160 1:116332812-116332834 CCAAGCTTCCTTTGGTGATGTGC No data
Right 913182163 1:116332825-116332847 GGTGATGTGCATAGGCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913182163 Original CRISPR GGTGATGTGCATAGGCAGAT AGG Intergenic
No off target data available for this crispr