ID: 913182165

View in Genome Browser
Species Human (GRCh38)
Location 1:116332849-116332871
Sequence TTGAGAATCACCTTATCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913182160_913182165 14 Left 913182160 1:116332812-116332834 CCAAGCTTCCTTTGGTGATGTGC No data
Right 913182165 1:116332849-116332871 TTGAGAATCACCTTATCTCAAGG No data
913182162_913182165 6 Left 913182162 1:116332820-116332842 CCTTTGGTGATGTGCATAGGCAG No data
Right 913182165 1:116332849-116332871 TTGAGAATCACCTTATCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913182165 Original CRISPR TTGAGAATCACCTTATCTCA AGG Intergenic
No off target data available for this crispr