ID: 913182166 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:116332855-116332877 |
Sequence | ATCACCTTATCTCAAGGTTT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
913182160_913182166 | 20 | Left | 913182160 | 1:116332812-116332834 | CCAAGCTTCCTTTGGTGATGTGC | No data | ||
Right | 913182166 | 1:116332855-116332877 | ATCACCTTATCTCAAGGTTTAGG | No data | ||||
913182162_913182166 | 12 | Left | 913182162 | 1:116332820-116332842 | CCTTTGGTGATGTGCATAGGCAG | No data | ||
Right | 913182166 | 1:116332855-116332877 | ATCACCTTATCTCAAGGTTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
913182166 | Original CRISPR | ATCACCTTATCTCAAGGTTT AGG | Intergenic | ||
No off target data available for this crispr |