ID: 913182166

View in Genome Browser
Species Human (GRCh38)
Location 1:116332855-116332877
Sequence ATCACCTTATCTCAAGGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913182160_913182166 20 Left 913182160 1:116332812-116332834 CCAAGCTTCCTTTGGTGATGTGC No data
Right 913182166 1:116332855-116332877 ATCACCTTATCTCAAGGTTTAGG No data
913182162_913182166 12 Left 913182162 1:116332820-116332842 CCTTTGGTGATGTGCATAGGCAG No data
Right 913182166 1:116332855-116332877 ATCACCTTATCTCAAGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913182166 Original CRISPR ATCACCTTATCTCAAGGTTT AGG Intergenic
No off target data available for this crispr