ID: 913182633

View in Genome Browser
Species Human (GRCh38)
Location 1:116336923-116336945
Sequence CAGTGACAGCAGCAGTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913182622_913182633 13 Left 913182622 1:116336887-116336909 CCACCCCAGGCAATCCTGTGGCA No data
Right 913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG No data
913182627_913182633 -1 Left 913182627 1:116336901-116336923 CCTGTGGCACCCACAGCAGTGGC No data
Right 913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG No data
913182623_913182633 10 Left 913182623 1:116336890-116336912 CCCCAGGCAATCCTGTGGCACCC No data
Right 913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG No data
913182624_913182633 9 Left 913182624 1:116336891-116336913 CCCAGGCAATCCTGTGGCACCCA No data
Right 913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG No data
913182628_913182633 -10 Left 913182628 1:116336910-116336932 CCCACAGCAGTGGCAGTGACAGC No data
Right 913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG No data
913182625_913182633 8 Left 913182625 1:116336892-116336914 CCAGGCAATCCTGTGGCACCCAC No data
Right 913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913182633 Original CRISPR CAGTGACAGCAGCAGTGGTG GGG Intergenic
No off target data available for this crispr