ID: 913187767

View in Genome Browser
Species Human (GRCh38)
Location 1:116385558-116385580
Sequence GAGTTATGAACCAGGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 2, 1: 34, 2: 79, 3: 154, 4: 397}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913187767_913187774 15 Left 913187767 1:116385558-116385580 CCACAGTTCCTGGTTCATAACTC 0: 2
1: 34
2: 79
3: 154
4: 397
Right 913187774 1:116385596-116385618 CAGTCGTTTGTTATAATGTTGGG 0: 1
1: 36
2: 92
3: 102
4: 195
913187767_913187773 14 Left 913187767 1:116385558-116385580 CCACAGTTCCTGGTTCATAACTC 0: 2
1: 34
2: 79
3: 154
4: 397
Right 913187773 1:116385595-116385617 ACAGTCGTTTGTTATAATGTTGG 0: 1
1: 34
2: 88
3: 125
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913187767 Original CRISPR GAGTTATGAACCAGGAACTG TGG (reversed) Intronic