ID: 913187773

View in Genome Browser
Species Human (GRCh38)
Location 1:116385595-116385617
Sequence ACAGTCGTTTGTTATAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 34, 2: 88, 3: 125, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913187770_913187773 -9 Left 913187770 1:116385581-116385603 CCATAGCCCTTATTACAGTCGTT 0: 1
1: 4
2: 44
3: 88
4: 147
Right 913187773 1:116385595-116385617 ACAGTCGTTTGTTATAATGTTGG 0: 1
1: 34
2: 88
3: 125
4: 171
913187769_913187773 -8 Left 913187769 1:116385580-116385602 CCCATAGCCCTTATTACAGTCGT 0: 1
1: 4
2: 39
3: 89
4: 132
Right 913187773 1:116385595-116385617 ACAGTCGTTTGTTATAATGTTGG 0: 1
1: 34
2: 88
3: 125
4: 171
913187768_913187773 6 Left 913187768 1:116385566-116385588 CCTGGTTCATAACTCCCATAGCC No data
Right 913187773 1:116385595-116385617 ACAGTCGTTTGTTATAATGTTGG 0: 1
1: 34
2: 88
3: 125
4: 171
913187767_913187773 14 Left 913187767 1:116385558-116385580 CCACAGTTCCTGGTTCATAACTC 0: 2
1: 34
2: 79
3: 154
4: 397
Right 913187773 1:116385595-116385617 ACAGTCGTTTGTTATAATGTTGG 0: 1
1: 34
2: 88
3: 125
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913187773 Original CRISPR ACAGTCGTTTGTTATAATGT TGG Intronic