ID: 913187774

View in Genome Browser
Species Human (GRCh38)
Location 1:116385596-116385618
Sequence CAGTCGTTTGTTATAATGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 36, 2: 92, 3: 102, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913187769_913187774 -7 Left 913187769 1:116385580-116385602 CCCATAGCCCTTATTACAGTCGT 0: 1
1: 4
2: 39
3: 89
4: 132
Right 913187774 1:116385596-116385618 CAGTCGTTTGTTATAATGTTGGG 0: 1
1: 36
2: 92
3: 102
4: 195
913187767_913187774 15 Left 913187767 1:116385558-116385580 CCACAGTTCCTGGTTCATAACTC 0: 2
1: 34
2: 79
3: 154
4: 397
Right 913187774 1:116385596-116385618 CAGTCGTTTGTTATAATGTTGGG 0: 1
1: 36
2: 92
3: 102
4: 195
913187768_913187774 7 Left 913187768 1:116385566-116385588 CCTGGTTCATAACTCCCATAGCC No data
Right 913187774 1:116385596-116385618 CAGTCGTTTGTTATAATGTTGGG 0: 1
1: 36
2: 92
3: 102
4: 195
913187770_913187774 -8 Left 913187770 1:116385581-116385603 CCATAGCCCTTATTACAGTCGTT 0: 1
1: 4
2: 44
3: 88
4: 147
Right 913187774 1:116385596-116385618 CAGTCGTTTGTTATAATGTTGGG 0: 1
1: 36
2: 92
3: 102
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913187774 Original CRISPR CAGTCGTTTGTTATAATGTT GGG Intronic