ID: 913189604

View in Genome Browser
Species Human (GRCh38)
Location 1:116402512-116402534
Sequence CAGGAAGTGAATGAGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913189604_913189610 20 Left 913189604 1:116402512-116402534 CCATCAGCCTCATTCACTTCCTG No data
Right 913189610 1:116402555-116402577 TCTGTGGTGCAAGATGAGACTGG 0: 1
1: 0
2: 1
3: 16
4: 187
913189604_913189609 4 Left 913189604 1:116402512-116402534 CCATCAGCCTCATTCACTTCCTG No data
Right 913189609 1:116402539-116402561 TTATGTGCAGACATCGTCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913189604 Original CRISPR CAGGAAGTGAATGAGGCTGA TGG (reversed) Intronic
No off target data available for this crispr