ID: 913189739

View in Genome Browser
Species Human (GRCh38)
Location 1:116403336-116403358
Sequence CTGAGCCCGAAGGCTTCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913189739_913189742 -5 Left 913189739 1:116403336-116403358 CCCTTGGAAGCCTTCGGGCTCAG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 913189742 1:116403354-116403376 CTCAGCTTTTTTCAGTCCCCAGG No data
913189739_913189743 1 Left 913189739 1:116403336-116403358 CCCTTGGAAGCCTTCGGGCTCAG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 913189743 1:116403360-116403382 TTTTTTCAGTCCCCAGGACCAGG 0: 1
1: 0
2: 1
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913189739 Original CRISPR CTGAGCCCGAAGGCTTCCAA GGG (reversed) Intronic
900228330 1:1543263-1543285 GTGAGCCTGGAGGCTGCCAAGGG - Intronic
900357952 1:2273760-2273782 CTCAGCCCGAACGCTGCCCACGG - Intronic
900368489 1:2321099-2321121 CTGACCCCACAGGCTTCCCAGGG + Intergenic
913189739 1:116403336-116403358 CTGAGCCCGAAGGCTTCCAAGGG - Intronic
913533082 1:119746992-119747014 CTGAGCCCGAGGCCTTCCTCTGG - Intergenic
916006383 1:160664954-160664976 CTGAGCACAAAGGCTGCCCATGG - Intergenic
922414531 1:225408479-225408501 CTGAGCCCCAAGGCTTTCACAGG + Intronic
1064208818 10:13347355-13347377 CTGAGCCCGAAGGTGTCCCCGGG - Intronic
1072202591 10:93174500-93174522 CTGATCTCTGAGGCTTCCAAGGG + Intergenic
1073131258 10:101190486-101190508 CTGTGCCCGAAGACGGCCAATGG + Intergenic
1075798893 10:125140254-125140276 CTGAGCTCAAAGGCATCAAAGGG + Intronic
1081655566 11:44854822-44854844 CTGAGCTTGGAGGCCTCCAAGGG + Intronic
1082883306 11:58059114-58059136 CTGAGCCCACAGGCTTTCGAAGG - Intronic
1083226360 11:61287361-61287383 CTGAGACCAAACGTTTCCAATGG + Intronic
1085741765 11:79083262-79083284 CGGAGGCCGAAGGCTTGCGATGG - Intronic
1086980437 11:93191476-93191498 CTGAGCCAGAAACCTTCCATAGG - Intronic
1091048595 11:132347981-132348003 CAGAGTCTGAAGGCTCCCAAAGG - Intergenic
1093169780 12:15847018-15847040 CTGAGTCTAAAGGCATCCAATGG - Intronic
1098598253 12:72297948-72297970 TTGAGCCCCAAGGTTTCCATTGG + Intronic
1099077681 12:78131063-78131085 CTGGGCCCTGAGGGTTCCAAGGG + Intronic
1100328140 12:93560464-93560486 CTCAGCCCAAAAGCTTCTAAAGG + Intergenic
1101530181 12:105566610-105566632 CTTCGTCCCAAGGCTTCCAAGGG - Intergenic
1101539494 12:105652244-105652266 CTGATGCCGAAGGCTTTGAATGG + Intergenic
1102007935 12:109600345-109600367 CTGAGCCAGGTGTCTTCCAAAGG - Intergenic
1102030551 12:109737863-109737885 CTGAGCCGGAGGCCTTCCAAGGG - Intronic
1102548975 12:113677257-113677279 CTCTGCCCGAGGGCTTCCGATGG + Intergenic
1120292656 14:82595465-82595487 ATGAGCACTCAGGCTTCCAAAGG + Intergenic
1121866919 14:97371069-97371091 CTGAGCCCTTGGGCATCCAAGGG + Intergenic
1122601910 14:102925668-102925690 CAGAGCCCAAGTGCTTCCAAAGG - Intronic
1128068124 15:64776508-64776530 CTGAGCCCGAAGGCTGGGGACGG + Intergenic
1129167746 15:73788394-73788416 CTGATTCCTGAGGCTTCCAAGGG + Intergenic
1131543958 15:93299978-93300000 CTGAGGCGGAAGGATTCCAAGGG + Intergenic
1133128188 16:3660175-3660197 CTGCGCCCGTGGGCTTCCAAGGG - Exonic
1133502001 16:6375631-6375653 CTGGGCTGGCAGGCTTCCAAGGG - Intronic
1138555938 16:57771213-57771235 CTGGGCCCGCAGGCTGGCAATGG + Exonic
1142099964 16:88265834-88265856 CTGAGCCTGGAGGCAGCCAAGGG - Intergenic
1147479100 17:40742005-40742027 CAGATCCAGCAGGCTTCCAATGG - Intergenic
1148830546 17:50428020-50428042 CTGAGCCCTGAGGCTTCTGAAGG - Intronic
1148909355 17:50932457-50932479 CTCAGCCCTAAGACTTCCAGTGG - Intergenic
1152301454 17:79497367-79497389 CAGACCCCTAAGGCTTCCAATGG + Intronic
1158511591 18:58095353-58095375 CTGAGCCTGAAGAATTCCCAGGG + Intronic
1159530538 18:69650310-69650332 CTGAGCTGGAAGTCATCCAAAGG + Intronic
1162032794 19:7924742-7924764 CGGAGCCCGAAGGCCTGCCATGG - Exonic
936015830 2:108958467-108958489 CTGAGGCAGAAGGCTCACAAGGG + Intronic
936144168 2:109968027-109968049 CTGAGCACGAGGGCTTGCCATGG - Intergenic
936180850 2:110265988-110266010 CTGAGCACGAGGGCTTGCCATGG - Intergenic
936200520 2:110403442-110403464 CTGAGCACGAGGGCTTGCCATGG + Intronic
936349756 2:111703759-111703781 GGGAGCCCACAGGCTTCCAAGGG - Intergenic
937680859 2:124642935-124642957 CTGTGCCCCATGGCTTCCAAAGG - Intronic
946032088 2:216713365-216713387 TTGAGCTACAAGGCTTCCAAAGG - Intergenic
1168758207 20:330441-330463 CTCAGCCCGAAGGCCTTCCAGGG + Intergenic
1169913587 20:10666860-10666882 CAAAGCCCCAAGGCATCCAAGGG + Intronic
1172942633 20:38664943-38664965 CTGACTCCAAAGGGTTCCAAGGG + Intergenic
1174250635 20:49217024-49217046 CTGAGCCCAGAGGCTCCCATGGG + Intergenic
1180252968 21:46601697-46601719 CAAAGCCCCAGGGCTTCCAAAGG + Intronic
1182257883 22:29051064-29051086 CTGAGGCTGAAGACTTCCAAGGG + Intronic
1184760198 22:46539315-46539337 CTGAGCCCGGAGCCTCCCAGTGG + Intergenic
949958696 3:9292827-9292849 CTGAGCTCCCAGGCTCCCAAGGG - Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
959757723 3:109918876-109918898 CTGAGCCCAAAGGCTCAGAAAGG - Intergenic
959782349 3:110249950-110249972 CTGAGCAAGAAGGATTCTAAGGG + Intergenic
961034964 3:123635796-123635818 GTGAACCAGAATGCTTCCAATGG + Intronic
961327722 3:126119177-126119199 CTGATCTCACAGGCTTCCAAGGG + Intronic
992476206 5:77104033-77104055 CTCAGCCACCAGGCTTCCAAAGG - Intergenic
1001659932 5:173383728-173383750 CTCAGCCGAAAGGCTTCCAGTGG + Intergenic
1004260432 6:14102980-14103002 CTGAGCCAGAGGACTTCCCACGG - Intergenic
1008559886 6:52713481-52713503 CTGTGCCCTGAGGCTTCCAGAGG + Intergenic
1014556358 6:122845609-122845631 CTGACTCCAAAGGCTTCCGAAGG - Intergenic
1019257158 7:59756-59778 CTGAGCCTGAGGGCTCCCAGTGG - Intergenic
1021146812 7:17099333-17099355 CTGAGTCCTAAGGCTACTAAGGG - Intergenic
1033616671 7:143023139-143023161 CTGAGCCCACAGGCTTCACATGG - Intergenic
1034962698 7:155372562-155372584 CTGAGCCCGCGGGCTTCTACCGG - Intergenic
1035640828 8:1183808-1183830 CTCTGCCTGAAGGCTTGCAAAGG - Intergenic
1038926148 8:32141963-32141985 CAGAGTCCAAAGGCTTCCCACGG - Intronic
1041528937 8:58840669-58840691 CTGTGCCCCAAGGCTACCTATGG + Intronic
1044902341 8:96960436-96960458 CTGAGCCCCTTGACTTCCAAAGG + Intronic
1045401035 8:101818070-101818092 CTGAGCCCAAATACTTCCCAGGG - Intronic
1052331487 9:27274203-27274225 CTGGGCCCGAATGATTCCAGTGG + Intergenic
1060192207 9:121600132-121600154 CCGATCCCCAAGGCTTCCAGCGG + Intronic
1062500553 9:136850227-136850249 CTGAGCACGCAGGCTTCCTGGGG + Intronic
1200750944 Y:6943604-6943626 CTGAGCCATAAGGATACCAATGG + Intronic