ID: 913192666

View in Genome Browser
Species Human (GRCh38)
Location 1:116426596-116426618
Sequence CCTACCCAGCACCAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913192666_913192678 15 Left 913192666 1:116426596-116426618 CCTCCCAGCTGGTGCTGGGTAGG No data
Right 913192678 1:116426634-116426656 GGGCATCCCTATGGCATGCCAGG No data
913192666_913192683 25 Left 913192666 1:116426596-116426618 CCTCCCAGCTGGTGCTGGGTAGG No data
Right 913192683 1:116426644-116426666 ATGGCATGCCAGGCTGGGTCAGG No data
913192666_913192675 6 Left 913192666 1:116426596-116426618 CCTCCCAGCTGGTGCTGGGTAGG No data
Right 913192675 1:116426625-116426647 CCCTTCCACGGGCATCCCTATGG No data
913192666_913192679 19 Left 913192666 1:116426596-116426618 CCTCCCAGCTGGTGCTGGGTAGG No data
Right 913192679 1:116426638-116426660 ATCCCTATGGCATGCCAGGCTGG No data
913192666_913192672 -5 Left 913192666 1:116426596-116426618 CCTCCCAGCTGGTGCTGGGTAGG No data
Right 913192672 1:116426614-116426636 GTAGGGCCATGCCCTTCCACGGG No data
913192666_913192671 -6 Left 913192666 1:116426596-116426618 CCTCCCAGCTGGTGCTGGGTAGG No data
Right 913192671 1:116426613-116426635 GGTAGGGCCATGCCCTTCCACGG No data
913192666_913192680 20 Left 913192666 1:116426596-116426618 CCTCCCAGCTGGTGCTGGGTAGG No data
Right 913192680 1:116426639-116426661 TCCCTATGGCATGCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913192666 Original CRISPR CCTACCCAGCACCAGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr