ID: 913193478

View in Genome Browser
Species Human (GRCh38)
Location 1:116433257-116433279
Sequence GCCTTGGGCTGCAGCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913193478_913193481 -6 Left 913193478 1:116433257-116433279 CCAGGGCAGCTGCAGCCCAAGGC 0: 1
1: 0
2: 6
3: 55
4: 428
Right 913193481 1:116433274-116433296 CAAGGCAAGTGTTTCTAGAGTGG 0: 1
1: 0
2: 1
3: 9
4: 180
913193478_913193482 11 Left 913193478 1:116433257-116433279 CCAGGGCAGCTGCAGCCCAAGGC 0: 1
1: 0
2: 6
3: 55
4: 428
Right 913193482 1:116433291-116433313 GAGTGGCCCTGAGCCACAGCTGG 0: 1
1: 1
2: 3
3: 23
4: 264
913193478_913193486 26 Left 913193478 1:116433257-116433279 CCAGGGCAGCTGCAGCCCAAGGC 0: 1
1: 0
2: 6
3: 55
4: 428
Right 913193486 1:116433306-116433328 ACAGCTGGCTACCACCCAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913193478 Original CRISPR GCCTTGGGCTGCAGCTGCCC TGG (reversed) Intergenic
900252580 1:1678787-1678809 TCCATGGGCTGCAGCCTCCCTGG + Intronic
900284148 1:1891245-1891267 GCCTTCGGGTACCGCTGCCCCGG + Intergenic
900400097 1:2469533-2469555 GCCATGGGCTGGCCCTGCCCGGG + Intronic
900422159 1:2560338-2560360 GCCCTGGCCTGCATCTGGCCGGG + Intronic
900438543 1:2642474-2642496 GCTGTGGGCTGCTGCTGGCCAGG + Intronic
900580793 1:3407739-3407761 ACAGTGGGCTCCAGCTGCCCAGG - Intronic
900591938 1:3464040-3464062 GGCCTGGGCTCCATCTGCCCCGG + Intronic
900592450 1:3466088-3466110 GCCGTGGGCAACACCTGCCCCGG + Intronic
901080094 1:6579282-6579304 GCCTTTGCCTGCAGCTACCTGGG + Exonic
901914866 1:12490812-12490834 GCCATGGGCTGCATCTGTCTTGG - Intronic
901914874 1:12490853-12490875 GCCGTGGGCTGCATCTGTCTTGG - Intronic
902277609 1:15350739-15350761 GGCTTGGGATACACCTGCCCTGG + Intronic
902321846 1:15673296-15673318 GCTTTTGTCTGCAGCTGACCTGG + Intergenic
903143314 1:21353420-21353442 GCCTGGAGCTCCAGCTACCCAGG - Intergenic
903210264 1:21814384-21814406 GCCTTCCGCTGCAGCCGACCTGG + Exonic
903550639 1:24155579-24155601 GCCTTGGGCTGCAGTTGCAGGGG - Exonic
903573300 1:24322039-24322061 GCCTGCGGCTCCAGCTCCCCGGG - Intronic
903935533 1:26892468-26892490 GGCCTGGGCTGCAGGTGCTCAGG - Exonic
904003969 1:27353719-27353741 GCTATGGGCTGCAGGTGCCCTGG + Exonic
904114314 1:28150351-28150373 GCGTTGCGCTGCTGCTGCACCGG + Exonic
904605668 1:31696380-31696402 GCCTTGGGCTGCAGGAACACAGG - Intronic
905881563 1:41467484-41467506 GCCCGGGGCTGCAGCTGGGCTGG + Intergenic
908380510 1:63593409-63593431 GGCTGAGGCTGCAGCTGCTCTGG - Intronic
909416323 1:75409831-75409853 ACCTTGGGCTGAAGCTGCCTTGG - Intronic
910478821 1:87636448-87636470 ACCTTGCGCTGCTGCTGGCCTGG + Intergenic
911676234 1:100661360-100661382 TCCTAGGTCAGCAGCTGCCCTGG + Intergenic
913193478 1:116433257-116433279 GCCTTGGGCTGCAGCTGCCCTGG - Intergenic
914813692 1:151047900-151047922 GCCTTGGGCCCCCGCCGCCCGGG - Exonic
915279093 1:154810223-154810245 GCCTTGGGCTGCCAGTGGCCTGG - Intronic
916720661 1:167482755-167482777 GCCTTGGGCTGCCCGTACCCTGG + Intronic
918076282 1:181173788-181173810 ACCAGGGGCTGCAGCTGTCCTGG + Intergenic
918076726 1:181176251-181176273 GCCCTGTTCTGCAGCTGCGCTGG + Intergenic
918571487 1:185998310-185998332 GCCTTCAGTTGCCGCTGCCCAGG - Intronic
919182622 1:194104604-194104626 GCTCTGGGCTGTAGCTGCTCAGG + Intergenic
919795630 1:201319883-201319905 GCCTTGGGATGCAGCTGCGGAGG + Intronic
920295631 1:204954476-204954498 CCCTTGGCCTGCAGTTGCCTTGG + Intronic
920499958 1:206479856-206479878 GTCTTTGTCTGCAGCTGCTCTGG + Exonic
921447209 1:215260868-215260890 GCACTGGTCTGCAGCTGCCAGGG - Intergenic
922889332 1:229048070-229048092 TCCTTGGGCTGCGGTGGCCCTGG - Intergenic
922911906 1:229225408-229225430 GCCATGAGCTGCTGCTGGCCGGG - Intergenic
923549903 1:234955282-234955304 GGCTTGGGCTCCATCTGCCTCGG + Intergenic
923552363 1:234974032-234974054 GGCTTGGACTCCAGCTGGCCAGG - Intergenic
924856479 1:247879654-247879676 GCATTCTGCTCCAGCTGCCCTGG + Intergenic
1062955743 10:1539169-1539191 GCCTTAGGATGTAGCTGCTCTGG + Intronic
1067051945 10:43026685-43026707 GCCTTGTCCTGCGTCTGCCCCGG - Intergenic
1067746638 10:48941198-48941220 CCCTTGTGCTGCAGCAGCCCTGG - Intronic
1069438521 10:68407282-68407304 GCTGTGGGCTGCAGCGGGCCTGG - Intronic
1069724325 10:70567524-70567546 GCCTGGAGCTGCAGGTCCCCCGG + Exonic
1069996132 10:72343235-72343257 GCCTTGGGCCCAAGTTGCCCAGG - Intronic
1070442107 10:76456385-76456407 GCCCTGAGCTGGAGCTTCCCTGG + Intronic
1070599748 10:77857361-77857383 CCCTTGGGCCCCAGCTGCCCTGG - Intronic
1071257086 10:83880545-83880567 GTCATGGGCTGCAGGTGCACAGG - Intergenic
1071506670 10:86236551-86236573 GCCTAGGGCTCAAGCTGTCCTGG - Intronic
1071511407 10:86264702-86264724 GGCTGGGCCTGCAGCTGCCTGGG - Intronic
1071589213 10:86856311-86856333 GCCCTGGGCTGCAGAGGGCCAGG - Intronic
1074854374 10:117462459-117462481 CCCTGGGGCTGCAGCAGGCCTGG + Intergenic
1075071600 10:119323599-119323621 GAGCTGGGCAGCAGCTGCCCGGG - Intronic
1075362820 10:121854793-121854815 AACTCGGGCTGCAGCTGCACAGG + Intronic
1075671063 10:124264461-124264483 GCCTGGGGCTGTCTCTGCCCTGG + Intergenic
1075882537 10:125866118-125866140 CCCACGGGCTTCAGCTGCCCCGG - Intronic
1075998354 10:126895885-126895907 GCCCTGGGCACCAGCTGACCTGG - Intergenic
1077311532 11:1890984-1891006 GGCTTGGCCAGCAGCTGGCCAGG - Intronic
1077374241 11:2198171-2198193 CCCCTGGGCTTCAGCTCCCCTGG + Intergenic
1077797477 11:5507718-5507740 GCCTCAGGCTGCAGCTGCTGGGG + Exonic
1078002952 11:7512757-7512779 GCTTTGGTCTGCTGCTGGCCAGG + Intergenic
1079128290 11:17733976-17733998 TCCTAGGGCTTCAACTGCCCTGG - Intergenic
1080302012 11:30794915-30794937 TCCTGGGGCTGCAGCTGCACTGG + Intergenic
1082010995 11:47449398-47449420 GCCTTGGGCTAGAGGTGCTCGGG + Intergenic
1082783242 11:57302660-57302682 CTCTTGGGCAGCACCTGCCCCGG + Exonic
1083155571 11:60820909-60820931 GGCTGGGGCTGCCACTGCCCTGG + Intergenic
1083421690 11:62556814-62556836 GCCATGGGCAGCAGCGGGCCTGG - Intergenic
1083637426 11:64128141-64128163 CTCTTGGGCTGCTCCTGCCCTGG - Intronic
1084178591 11:67435754-67435776 GCCCTGGCCCCCAGCTGCCCTGG + Exonic
1084476202 11:69391101-69391123 TCGTTGGACAGCAGCTGCCCTGG + Intergenic
1084590910 11:70089697-70089719 GCCTTTGGGGGCAGCTGCCAGGG + Intronic
1084860570 11:72015315-72015337 GCGCAGGGCTGCAGATGCCCTGG - Exonic
1085771355 11:79328894-79328916 GCCTTGGGCTACATCAGCTCTGG - Intronic
1089061787 11:115631719-115631741 GCCTTGGGGAGCAGGTGACCTGG + Intergenic
1089273195 11:117315661-117315683 CCCTGGGGCTGCGGCTGCCCCGG - Exonic
1089622212 11:119728666-119728688 GCCGACGGCTGCAGCTGACCTGG - Exonic
1089738994 11:120569140-120569162 GCCTGGAGCTGCAGATGCCCCGG - Intronic
1090190250 11:124762267-124762289 GACTTGGGCTGGAGCCGCCCTGG - Exonic
1090601823 11:128380085-128380107 GCCTTGGGTTGATGCTGTCCAGG + Intergenic
1091219237 11:133920504-133920526 GCCTTGGGCTGCAGACTCTCGGG + Exonic
1091317313 11:134623741-134623763 GCCACGTGCTGCAGCTGCCTAGG + Intergenic
1091395537 12:152215-152237 GCTGTGGGCTCCAGGTGCCCAGG + Intronic
1091401017 12:180739-180761 GCTCTGGGCAGCAGCTGCCTCGG - Intergenic
1091837744 12:3597638-3597660 GCCAAGGGCAGCAGCGGCCCAGG + Intergenic
1091991621 12:4960446-4960468 GCCTTGGGCAGCAGTGGGCCTGG - Intergenic
1092145772 12:6213742-6213764 GCCTGAGGGTGCAGCTTCCCAGG + Intronic
1094512694 12:31105807-31105829 GCCTTGGACTGCAGTGGCCGGGG + Intergenic
1096517515 12:52165292-52165314 GCCGGGGGCTGCAGCTGCAGAGG - Intergenic
1096606087 12:52767543-52767565 GCCCTAGGCTGCCCCTGCCCAGG + Intergenic
1097692287 12:62744765-62744787 GTCCTGGGCTGCAGCTGTCCTGG - Intronic
1099033595 12:77559511-77559533 GACTTGGGCTGCAGCTGGGAAGG + Intergenic
1099958024 12:89370079-89370101 GCCTTCACCTGCAGCTGCCCTGG + Intergenic
1101712874 12:107284820-107284842 GCCTTGAGGTGCAGCAGCCATGG + Intergenic
1102463471 12:113114684-113114706 CCCTGGGGCTACAGCTGCTCAGG - Intronic
1102601913 12:114037704-114037726 GCTGGCGGCTGCAGCTGCCCTGG + Intergenic
1103623804 12:122204234-122204256 GCCTTGGGCGGCAGCCGCCTCGG - Intronic
1104004513 12:124882637-124882659 GCCTGGTGCTGCTGCTGCTCTGG - Intronic
1104013922 12:124950089-124950111 ACCGTGGGCAGCAGCAGCCCGGG - Intronic
1104376547 12:128268439-128268461 GACTCGGGCAGCTGCTGCCCTGG - Intronic
1104856098 12:131903173-131903195 GCCTGGGCCTGCAGCTGCCCTGG + Intronic
1106673480 13:31932403-31932425 GCCTGTGGTTCCAGCTGCCCAGG - Intergenic
1107005917 13:35611577-35611599 GCCTTGGGCTGGAGGTGGGCAGG - Intronic
1107829101 13:44358545-44358567 GCCTTGGGCACCAGCTTGCCTGG - Intergenic
1111143801 13:84155778-84155800 TCCTTGGGCTGTTGCAGCCCAGG + Intergenic
1111951837 13:94713729-94713751 GGCCTGGCGTGCAGCTGCCCTGG + Intergenic
1112160945 13:96867434-96867456 GTGTTGGGCTTCACCTGCCCAGG - Intergenic
1112507505 13:99983796-99983818 GCCTGGGGCTCTAGCTGACCTGG - Intronic
1113033845 13:106026241-106026263 GCCTTTGTCTTCAGCTTCCCTGG - Intergenic
1113236784 13:108284890-108284912 GCTTGGGGCTTTAGCTGCCCCGG + Intronic
1113552056 13:111200170-111200192 GCCTTGGGCTGCGGCCTCTCTGG + Intronic
1113698410 13:112365021-112365043 AGCTTAGGCTGCACCTGCCCAGG - Intergenic
1114658422 14:24329823-24329845 GCCTTCTGCTGTAGCTGCCTAGG + Intronic
1115771481 14:36666840-36666862 GTCTGGGGCGGCAGCTCCCCGGG + Intronic
1116130286 14:40847671-40847693 GACTGGGGCTGCATCTGTCCAGG + Intergenic
1118476812 14:66125126-66125148 GCCTTTGGCTGCAGCACCACAGG - Intergenic
1119701973 14:76761758-76761780 CGCTCGGGCTGCAGCTGCCCTGG - Intergenic
1121011574 14:90523074-90523096 CCCTTGGGCTGCTGTTGCCCTGG - Intergenic
1121017189 14:90555976-90555998 GCCTTAGGCTGCAGCCGGCAGGG - Intronic
1121312996 14:92945197-92945219 GCCCTGGGCGACAGCAGCCCTGG + Intronic
1121680417 14:95788654-95788676 CCCTTGTCCTGCAGCAGCCCAGG - Intergenic
1121871733 14:97414249-97414271 GCCTTGGGCTGCGGCTGCTACGG + Intergenic
1122804675 14:104250398-104250420 GCCATGCACTCCAGCTGCCCAGG - Intergenic
1122846764 14:104504493-104504515 TCCTGGTGCTGCAGGTGCCCTGG + Intronic
1122946150 14:105011041-105011063 GCCTAGGGCTGCAGCCCCACTGG + Exonic
1122973767 14:105162814-105162836 GCCCTGGGCTGGGGGTGCCCTGG - Intronic
1123037281 14:105476645-105476667 GCCCTGGGCTGCAGCTGCCACGG + Intronic
1123207164 14:106724744-106724766 GCCTTGCTCTGCACCTGCACTGG + Intergenic
1123212189 14:106771747-106771769 GCCTTGCTCTGCACCTGCACTGG + Intergenic
1202947482 14_KI270726v1_random:41941-41963 GCCGTGAGCTGCACCTGCGCCGG - Intergenic
1123427928 15:20187884-20187906 GCCTTAGACAGCAGCTGCCAGGG + Intergenic
1123696142 15:22880492-22880514 GCCTTGCTCTGGAGCTGGCCTGG - Intronic
1123996411 15:25720992-25721014 GCCTGGGGCTGCAGCGCCCTGGG - Intronic
1124712881 15:32030229-32030251 GCCTTGGGCAGCCCCTGGCCTGG + Intergenic
1125933525 15:43616345-43616367 GCCTTGGGCACCTGGTGCCCAGG + Exonic
1125946623 15:43715807-43715829 GCCTTGGGCACCTGGTGCCCAGG + Intergenic
1125973176 15:43928724-43928746 CCCTTTGCCTGCAGGTGCCCTGG + Intronic
1127153504 15:56104373-56104395 GCCTTGGTCTGCTGCTGAACTGG - Intronic
1127165755 15:56243742-56243764 GCCTGGGGCTGCAGCAGCACGGG - Intergenic
1127583801 15:60362564-60362586 GATACGGGCTGCAGCTGCCCAGG - Intronic
1128323132 15:66706337-66706359 GACTTGGGGTGCTGCAGCCCTGG - Intronic
1129165726 15:73776193-73776215 CCCCTGGGCTGCAGCTCCCTAGG - Intergenic
1131430225 15:92381639-92381661 GCTTTGGTCTGCAGCTGACCTGG + Intergenic
1131831482 15:96357340-96357362 GGCTGGGGCTGCAGGTCCCCAGG + Intergenic
1132303085 15:100788416-100788438 GCCAGGGGTTGCTGCTGCCCAGG - Intergenic
1132515121 16:362674-362696 GCCTTGGGCTGCTGCAGCCCAGG + Intergenic
1132581205 16:685501-685523 GCCTTGTCCTGCAGGTGCTCGGG + Exonic
1132590506 16:724393-724415 GCCGTGAGCAGCAGCTGGCCCGG - Exonic
1132728399 16:1348709-1348731 GACTTGGCCAGCAGCTGCCCAGG + Exonic
1132855070 16:2041068-2041090 GGCTGGGGCTGCAGCTGGCCGGG - Intronic
1133125114 16:3641514-3641536 GGCTTGGGCAGCATCTGTCCTGG + Intronic
1133933412 16:10250343-10250365 GCAGGAGGCTGCAGCTGCCCTGG - Intergenic
1134319410 16:13149255-13149277 GGCTGGGACTCCAGCTGCCCAGG + Intronic
1134521812 16:14922263-14922285 ACCCTGGGCTGCGGCTGCCTGGG + Intronic
1134709482 16:16320914-16320936 ACCCTGGGCTGCGGCTGCCTGGG + Intergenic
1134716695 16:16360943-16360965 ACCCTGGGCTGCGGCTGCCTGGG + Intergenic
1134950121 16:18347731-18347753 ACCCTGGGCTGCGGCTGCCTGGG - Intergenic
1134958055 16:18391216-18391238 ACCCTGGGCTGCGGCTGCCTGGG - Intergenic
1135562499 16:23487480-23487502 GACTAGGTCTGCAGTTGCCCTGG + Intronic
1135937704 16:26795245-26795267 GCCTTGAGCTGCAGGTAGCCTGG - Intergenic
1136056236 16:27691899-27691921 GCATAGGGCTGCAGCAGCCAAGG + Intronic
1136105158 16:28025191-28025213 GCCATGTCCTGCACCTGCCCAGG + Intronic
1136144316 16:28306998-28307020 ACCTTGCCCTGCAGATGCCCTGG - Intronic
1136614678 16:31390672-31390694 GCCTGGAGCTGGAGCTGCCAAGG - Intergenic
1137572556 16:49576294-49576316 CCCTTGGACAGCAGCTGGCCAGG - Intronic
1137607094 16:49794158-49794180 GCCTGTGGCTCCAGCTGCTCGGG - Intronic
1138455591 16:57119008-57119030 CCAGGGGGCTGCAGCTGCCCTGG + Intronic
1138563601 16:57816635-57816657 GCCTGGTGTGGCAGCTGCCCAGG - Intronic
1139599348 16:67977217-67977239 GGCTTGGGCTGTGGCTGCCAGGG - Intronic
1140047959 16:71454952-71454974 CCCAGAGGCTGCAGCTGCCCAGG - Intronic
1140456327 16:75107652-75107674 CTCTTGGGATGCAGCTGCCCTGG + Intronic
1140808878 16:78558136-78558158 CTCCTGGGCAGCAGCTGCCCTGG + Intronic
1141662335 16:85448203-85448225 GCTTTGTGTTCCAGCTGCCCAGG + Intergenic
1142067132 16:88069025-88069047 GCCTGGGGCTGGAGCTGGGCTGG - Intronic
1142251307 16:88993275-88993297 GCCCCGGGCTGCAGCTGGGCAGG + Intergenic
1142427137 16:90007202-90007224 ACCTGGGGCTGCAGCAGCCTGGG + Intronic
1143770508 17:9165516-9165538 GCCATGGACAGCAGCTGCCCCGG + Intronic
1144714401 17:17424137-17424159 GGGGTGGACTGCAGCTGCCCTGG - Intergenic
1144829857 17:18125237-18125259 GCCTGGGGCTGGCCCTGCCCTGG + Intronic
1145078767 17:19877011-19877033 GACATGGGCTGCAGCTTCTCAGG - Intergenic
1145907424 17:28524124-28524146 GCCAAGGCCTGCGGCTGCCCAGG + Intronic
1146070010 17:29671730-29671752 GCCTTGGGGTGAAGCTTCTCAGG + Intronic
1146588883 17:34110521-34110543 GCCCTGGGCTGTAGCTGCAGAGG + Intronic
1147962848 17:44178250-44178272 GCCAGGTGCTGCAGCTGCCTTGG - Exonic
1148070241 17:44904487-44904509 GCCTTGGTCCGCAGCTTCCTTGG - Exonic
1148576093 17:48712346-48712368 GCCGTGGGCTGGCCCTGCCCTGG - Intergenic
1148960193 17:51386052-51386074 GCCTGGGCCTGCAGATACCCTGG + Intergenic
1151704698 17:75760809-75760831 GCCTTTGGTTGCAGCTACCCAGG + Intronic
1152070413 17:78131415-78131437 CCCTAGGGCTGCAGGAGCCCAGG + Exonic
1152107905 17:78341748-78341770 GCCCGGGGCCGCAGCTGCTCGGG + Intergenic
1152132157 17:78484235-78484257 GATTCTGGCTGCAGCTGCCCTGG + Intronic
1152630802 17:81409975-81409997 CACCTTGGCTGCAGCTGCCCCGG + Intronic
1153713283 18:7820957-7820979 TCCTTGGGGGGCAGCTGACCAGG - Intronic
1153978377 18:10289026-10289048 GCCTTGGGATGCTTCTTCCCAGG - Intergenic
1154384287 18:13879611-13879633 GCCCTGGGATGCTGATGCCCTGG - Intergenic
1154415643 18:14174017-14174039 GCCTTGGCCTGTCCCTGCCCTGG - Intergenic
1158458146 18:57625252-57625274 CCCATTGGCTGCAGCTGACCAGG - Intergenic
1158763614 18:60421267-60421289 GCCTTCGTCTGCAGCTGATCTGG - Intergenic
1160329271 18:77977386-77977408 CCCTGGGGCTGCATCTCCCCAGG - Intergenic
1160540570 18:79617965-79617987 GCCTTGGCCAGCGGGTGCCCCGG + Intergenic
1160679670 19:406987-407009 GGCTTGGGCTGGGGCTGGCCGGG - Exonic
1161017666 19:1991257-1991279 GTCTTGGGATGGAGCTGCCGGGG - Intronic
1161120374 19:2522316-2522338 GGCTGGGACTGCGGCTGCCCAGG - Intronic
1161222380 19:3123588-3123610 GCCGGGGGCTGCTGCCGCCCGGG - Exonic
1161281382 19:3447607-3447629 GCCATGGGCTTCACCTGCACAGG + Intronic
1161366296 19:3881674-3881696 GCCTGTGGCTGCAGCTGGCAGGG + Intronic
1161948080 19:7451295-7451317 GCCCTGTGCTGCAGCAGCACGGG - Intronic
1162153257 19:8660133-8660155 GCCCTGGGCTCCGGCTGCCCAGG + Intergenic
1162503024 19:11065302-11065324 GCCTGGGGCTGCTCCTGGCCTGG - Intronic
1162733500 19:12733026-12733048 GCCTGGAGCTCCAGCTACCCAGG - Intronic
1162792544 19:13070491-13070513 GGCCCTGGCTGCAGCTGCCCCGG + Intronic
1163130881 19:15272257-15272279 GGCTGTGGCTGCAGCTGCACAGG - Intronic
1163338606 19:16689694-16689716 GCCTTGTGCTGCTGCTGGGCGGG + Exonic
1163720355 19:18895664-18895686 GCCTCGGGCTGGAGAGGCCCAGG - Intronic
1164682571 19:30145451-30145473 CCCATGGGGTACAGCTGCCCTGG + Intergenic
1164739246 19:30564479-30564501 TCCTGGGGCTGTAGGTGCCCAGG + Intronic
1164853918 19:31505849-31505871 GCTTTGGGCTCTAGCTGCCTGGG - Intergenic
1164996164 19:32721054-32721076 CCCATGGGCTGGGGCTGCCCGGG - Intronic
1165123614 19:33579078-33579100 GGCATGGGCTGCAGCTCCTCGGG + Intergenic
1165144867 19:33724601-33724623 GCCTGGGGCTGCATCTGCCTCGG + Intronic
1167467396 19:49657587-49657609 GCCCTCTGCTGCAGGTGCCCGGG - Intronic
1167586957 19:50380749-50380771 TCCTTGTGCTCCAGCTGCCTGGG - Intronic
1167756392 19:51415986-51416008 CCCTGGGGCTGGAGCTGCCCGGG - Exonic
1168710965 19:58499663-58499685 ACCTTGGTCAGCAGCAGCCCCGG + Exonic
925140949 2:1549536-1549558 GCCACTGGCTGCAGCTGCTCCGG - Intergenic
925293939 2:2765684-2765706 GGCCTGGGCAGCAGCTGCCATGG + Intergenic
926103807 2:10137736-10137758 CCCTGGGGCAGCAGCTGCCTGGG + Intergenic
926309167 2:11662108-11662130 GGCTGGGGGTGGAGCTGCCCGGG + Exonic
927142008 2:20137121-20137143 GCCTCCGGCTGCAGCTCTCCAGG + Intergenic
928001093 2:27523547-27523569 ACCCTGGGCTGCGGATGCCCTGG - Exonic
928158116 2:28894903-28894925 ACCTTGGCCTGCAGCCGCGCTGG - Exonic
928240126 2:29578838-29578860 GCCTGGGACTGCATCTACCCTGG + Intronic
929015266 2:37487359-37487381 GCCTTGGGCTGCCTCAGCGCTGG + Intergenic
929922401 2:46182087-46182109 CCCTTCGGCTCCAGCTCCCCCGG + Intronic
933666656 2:84970678-84970700 GCCTTGGGCTGCGCCGGCCGCGG - Intergenic
933699356 2:85243653-85243675 GCCTGGGGCTGCCTCTGGCCAGG - Intronic
934067706 2:88354765-88354787 CCCTTGGGGGGCAGCTGCCTGGG - Intergenic
934233640 2:90210079-90210101 GCCTGGGGCTCCTGCTGCTCTGG + Intergenic
935120161 2:100177207-100177229 GCCTTGTGCTATAACTGCCCAGG + Intergenic
935173396 2:100628153-100628175 CCCCTGGGATGCAGCTGCCTTGG - Intergenic
935717516 2:105952287-105952309 CCCTTGGCCAGCAGCTCCCCAGG + Intergenic
936517754 2:113192983-113193005 GGCTGGGGCTGCAGATGCACTGG - Intronic
936532100 2:113283495-113283517 GCCTTTGGCAGCAGTTGCCTGGG + Intergenic
937215980 2:120313924-120313946 GCCCTGTGCAGCGGCTGCCCCGG + Intergenic
937904366 2:127045767-127045789 GGGGTGGGCTGCAGCAGCCCAGG - Intergenic
937939562 2:127274562-127274584 GCCTGGGTGTGCAGCTGCCCAGG - Intronic
938694452 2:133822871-133822893 GCCATGGGCTGCAGGTACCCGGG - Intergenic
938953991 2:136281982-136282004 GCCGTGGGATGCTGCTGCCCAGG + Intergenic
939887892 2:147701170-147701192 GACTTGGAGGGCAGCTGCCCTGG - Intergenic
940533596 2:154909175-154909197 GCACTGGGCAGCAGCTGCTCAGG + Intergenic
941916572 2:170817381-170817403 GCCTTCGGCTGCTGCTGCCCAGG - Intronic
942133960 2:172906997-172907019 GCCTGGGGCTGCTCCTGCCTGGG - Intronic
942947341 2:181684352-181684374 GCCTGAGGCTGGAGCTGCCCAGG + Intergenic
946422484 2:219572430-219572452 GCCAGGGGCTGGAGCTGGCCCGG + Exonic
946610119 2:221448873-221448895 CCCATGGCCTGAAGCTGCCCGGG + Intronic
947793918 2:232882638-232882660 ACCTGGGGCTGCAGCTGACGTGG - Intronic
948597608 2:239090239-239090261 AACGTGGGCTGCAGCTGCCCTGG - Intronic
948647961 2:239420628-239420650 GCCTTGGGCTGCATCTGCACAGG - Intergenic
948689464 2:239692657-239692679 TCCCTGGGCTTCAGCTGCCTGGG + Intergenic
948980040 2:241489767-241489789 CCCCTGGGGTGCAGCTGCCATGG + Intronic
949056775 2:241932173-241932195 GCCTCGGGCGCCAGGTGCCCTGG + Intergenic
1171237021 20:23535318-23535340 GGATTCAGCTGCAGCTGCCCAGG - Intergenic
1171412332 20:24955936-24955958 GCCTTGTGCTTTAGCAGCCCAGG - Intronic
1172120657 20:32596871-32596893 TCCCTGGGATGCAGCTGTCCAGG - Intronic
1172592480 20:36127532-36127554 GCCTGGGGCAGATGCTGCCCAGG - Intronic
1172770824 20:37381709-37381731 TCCTTGGGCTGCAGGTAACCAGG + Intronic
1172795899 20:37537277-37537299 CCCCTGGGCTTCTGCTGCCCTGG + Intergenic
1172835009 20:37867897-37867919 GCCTGAGGGTGCAGCTTCCCCGG + Intronic
1173730789 20:45327059-45327081 GCTTTGGGCCTCAGTTGCCCTGG - Exonic
1175293491 20:57893610-57893632 ACCATGGGCTGCAGCAGCCTCGG - Intergenic
1175762378 20:61570413-61570435 ACTTTGGGCTTCAGCAGCCCTGG + Intronic
1175780384 20:61678722-61678744 CTCTGGGGCTCCAGCTGCCCTGG + Intronic
1175835415 20:61990673-61990695 GCCCTGTGCTGCAGGAGCCCTGG - Intronic
1176167765 20:63682923-63682945 GCCTGAGGCCGGAGCTGCCCTGG + Intronic
1176229906 20:64027176-64027198 CCCTGGGGCTGCAGCTGACCCGG + Intronic
1176368097 21:6045679-6045701 GCCCTGGGGTGCTGTTGCCCTGG + Intergenic
1176857685 21:13985259-13985281 GCCTTGGCCTGTCCCTGCCCTGG + Intergenic
1176866914 21:14058940-14058962 GCCTTGGCCTGTCCCTGCCCTGG - Intergenic
1178541244 21:33452603-33452625 GTCCTGGGCTACAGCTGCTCTGG + Intronic
1179108417 21:38424254-38424276 TCCTTGGGTTGCAGATGGCCTGG - Intronic
1179466739 21:41580941-41580963 GCCTTCTGCTGGCGCTGCCCAGG + Intergenic
1179755422 21:43492863-43492885 GCCCTGGGGTGCTGTTGCCCTGG - Intergenic
1180075571 21:45459781-45459803 GGCTTGGGCTTGGGCTGCCCGGG + Intronic
1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG + Intergenic
1180141453 21:45895931-45895953 GCCGAGGTCTGCATCTGCCCAGG - Intronic
1180833527 22:18918599-18918621 GCCCTGAGCTGCACCTCCCCAGG - Intronic
1180948024 22:19707554-19707576 GCCGTGGCCAGCACCTGCCCAGG + Intergenic
1180980038 22:19874074-19874096 TCCTTGGGCTCCTGCTGCACAGG - Intergenic
1181035897 22:20169604-20169626 GCCCTGGGGGGCAGCAGCCCAGG + Intergenic
1181048717 22:20228706-20228728 TCCCTGGGCAGCAGCTGACCTGG - Intergenic
1181066301 22:20307656-20307678 GCCTTGAGCTGCACCTCCCCAGG + Intergenic
1181437665 22:22919887-22919909 GCCTGGAGCTGCAGGTTCCCAGG + Intergenic
1181438313 22:22922942-22922964 GCCTGGAGCTGCAGGTTCCCAGG + Intergenic
1181683906 22:24515408-24515430 GCCTTGGGCTTTAGCTGGCTGGG - Intronic
1181693930 22:24583507-24583529 AGCTTGGGCTGGAGCTGTCCTGG + Intronic
1182361725 22:29750482-29750504 ACCTTGGGCTGCAGATCTCCTGG - Intronic
1182468464 22:30532487-30532509 GTGTCCGGCTGCAGCTGCCCAGG + Intronic
1182758442 22:32700301-32700323 GCCTTGGACAGCAGCCTCCCTGG + Intronic
1183214140 22:36468217-36468239 GCCCTGGCCTGCAGCTGCAAGGG - Intronic
1183264745 22:36818276-36818298 GCCTTGGGCTGTGGTGGCCCTGG + Intronic
1183360924 22:37383092-37383114 GCCCTTGGGTACAGCTGCCCGGG + Intronic
1183440021 22:37817857-37817879 GCCTTGGGCCGCGGCTGTTCAGG + Intergenic
1183663251 22:39233703-39233725 TCCTGGGCCTGCAGCTGTCCTGG - Intronic
1183737500 22:39651918-39651940 GCCTGAGGCTGGACCTGCCCTGG - Intronic
1183933295 22:41248299-41248321 CCCTTGGGCTGCAGCTGGACTGG - Intronic
1183965033 22:41436493-41436515 GGCCTGGGGTGCCGCTGCCCTGG + Exonic
1184018084 22:41800783-41800805 GCCGCGGGCTGCAGGTTCCCGGG + Intronic
1184235486 22:43180851-43180873 GCCATGCGGTGCAGCAGCCCGGG + Exonic
1184302664 22:43571581-43571603 GCCTTCCCCTGCAGCCGCCCTGG + Intronic
1184474092 22:44711369-44711391 GCCCCAGGCTGAAGCTGCCCTGG - Intronic
1184872714 22:47251193-47251215 GCCTGTGGCTGAAGCTACCCAGG - Intergenic
1185150781 22:49162851-49162873 GCCCTGGGCTGCACCTGCCCAGG - Intergenic
1203283612 22_KI270734v1_random:143897-143919 GCCCTGAGCTGCACCTCCCCAGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949880689 3:8658406-8658428 CCCTTGGGGACCAGCTGCCCTGG - Intronic
950260351 3:11538747-11538769 GCCTGTGGTTGCAGCTACCCAGG + Intronic
950467819 3:13165738-13165760 GCCTGGGGCTGCAGCAGCGAGGG - Intergenic
950643585 3:14363911-14363933 GCCTTGGTAAGCAGCTACCCTGG + Intergenic
950864303 3:16176510-16176532 TCCTGGGGCTGGGGCTGCCCTGG - Intronic
950964051 3:17133998-17134020 GACTTGGATTGCATCTGCCCAGG + Intergenic
952110518 3:30118756-30118778 GCCTTTGGGGGCAGCTCCCCTGG + Intergenic
952818784 3:37468168-37468190 GCCCTGGGATGCACCTCCCCAGG - Intronic
954292124 3:49655278-49655300 CCCTTTGGCAGCAGCTGCACTGG + Exonic
955369977 3:58342830-58342852 GCTTTGGGTTGCAGCTTGCCTGG + Intronic
958128102 3:89383500-89383522 GCCCTGTGCTGGAACTGCCCTGG + Intronic
958562135 3:95760035-95760057 GCCCGGGTCTGCAGCTGCCTAGG + Intergenic
961388192 3:126536285-126536307 GCCCTGGGCTCCAGCTGGCTTGG + Exonic
961954734 3:130789722-130789744 CCCTGGCGCTGCAGCTGGCCAGG + Intergenic
962134770 3:132722243-132722265 GCCTTGGGCTTCACCTCCACCGG + Exonic
962266792 3:133949532-133949554 GCCTTAGGCTGGAGCTGACAAGG - Intronic
962315161 3:134354729-134354751 GCCATGGGCTGCTGTGGCCCAGG + Intergenic
965390217 3:168095484-168095506 AAGTTTGGCTGCAGCTGCCCGGG - Exonic
966411944 3:179653553-179653575 GTCCTCGGCTGCAGCAGCCCTGG - Intronic
968086310 3:195875497-195875519 GCCTTGGGATGAAGCTGCCTTGG - Intronic
968134387 3:196210761-196210783 GCTTTGGGCTGCCCCTGCTCAGG - Intronic
968622320 4:1609348-1609370 GCCCAGGCCTGCACCTGCCCCGG + Intergenic
968728103 4:2257534-2257556 GCCCTAGGCTGGAGCTTCCCAGG + Intronic
968914833 4:3492880-3492902 GCCTAGACCAGCAGCTGCCCAGG + Exonic
969094236 4:4719951-4719973 GCCCTGTGATGCAGCAGCCCCGG + Intergenic
969442267 4:7224409-7224431 GCCTGCTGCTGCAGCTTCCCAGG - Intronic
969574381 4:8028086-8028108 GCCTTGGGCTGGGGTTCCCCAGG + Intronic
969686968 4:8681072-8681094 GCATGTGGCTGGAGCTGCCCAGG + Intergenic
971362558 4:25951294-25951316 ACCTTGGCCTGGAGATGCCCTGG + Intergenic
971526144 4:27621077-27621099 AGGTTGGGCTTCAGCTGCCCTGG - Intergenic
972094636 4:35333930-35333952 GCCTTGGGCAGCTCCTTCCCAGG + Intergenic
978201644 4:106029310-106029332 CCCCAGGGCTGGAGCTGCCCAGG + Intergenic
978503219 4:109431707-109431729 GCCTTGTGCTGTCGCTGCCGTGG - Intergenic
979433823 4:120665026-120665048 GGCTTGGGATGCAAGTGCCCTGG - Intergenic
980749612 4:137071062-137071084 GCACTAGGCTGCAGCTGCTCAGG + Intergenic
980901608 4:138910635-138910657 GCCGTGGGCTGCACCTGCCGGGG + Intergenic
981579041 4:146233852-146233874 CCCATGGACTCCAGCTGCCCTGG - Intergenic
982122779 4:152158475-152158497 GCTCTGGGCTGCAGCCACCCTGG - Intergenic
984929293 4:184832484-184832506 TGCTTAGGCCGCAGCTGCCCAGG + Intergenic
985792492 5:1937711-1937733 CCTCAGGGCTGCAGCTGCCCGGG + Intergenic
985994476 5:3590282-3590304 GCCTTAAGCTGAAACTGCCCTGG - Intergenic
986236648 5:5916749-5916771 GCCTTAGCCTGCAGCTTCCCTGG + Intergenic
986674317 5:10169678-10169700 GCCTTGGGCTCCAGGAGGCCAGG + Intergenic
986768965 5:10954533-10954555 GCCTTTGTCTGCAGCTGTCCTGG - Intergenic
987309212 5:16666688-16666710 GCCTTCACCTGGAGCTGCCCTGG + Exonic
988456140 5:31388805-31388827 GCCTTGGGCTGCTGCTTCAGAGG - Intergenic
990986042 5:61641952-61641974 GCCTGGGGCTGCAGCAGTGCTGG + Intronic
991045463 5:62218202-62218224 GCCTTAGACAGCAGCTGCCAGGG + Intergenic
993716558 5:91280653-91280675 GCCCCGGGCTGCGGCCGCCCAGG - Intergenic
994325883 5:98444006-98444028 GCCATGGGAAGCAGCTGCCTTGG + Intergenic
996884718 5:128341555-128341577 ATCTTGGGATACAGCTGCCCAGG - Intronic
997355363 5:133259367-133259389 GCCATGTGCTTCAGCTGCACTGG - Intronic
997952599 5:138253831-138253853 GCCTTAAGCTGCACCTGCCGAGG - Exonic
1001694658 5:173661001-173661023 GCCTAGGGCTGCAGCTGGCATGG + Intergenic
1002065006 5:176647529-176647551 GCCCTGGGCTAGAGCCGCCCGGG - Exonic
1002184524 5:177447810-177447832 GGCCTGGGCTTCAGCTTCCCTGG - Intronic
1003161112 6:3635626-3635648 GTCCTGAGCAGCAGCTGCCCTGG + Intergenic
1003325131 6:5085296-5085318 GCTTTTAGCTGCGGCTGCCCAGG - Exonic
1004696910 6:18042638-18042660 GCCTGGGTCTGCAGCTGCATTGG - Intergenic
1006107789 6:31727207-31727229 GCCTTGGGGTACTGCTGGCCAGG - Exonic
1006297217 6:33175020-33175042 GCCCTGCTCTGCAGCTGCCTGGG - Intronic
1006303792 6:33207489-33207511 GACTTGGGCTGCGGCTGCCAGGG - Intergenic
1006370307 6:33640218-33640240 GACTGGAGCTGCAGCTGTCCTGG - Intronic
1006446676 6:34083685-34083707 GCCTTGGGCCGCAGGGTCCCTGG + Intronic
1007072736 6:39048866-39048888 GCCTTGCGCTGCTGCTGCTCGGG + Exonic
1007665947 6:43512996-43513018 GCCTTGGTCGGCATCTGTCCTGG - Intronic
1007782567 6:44262972-44262994 GCTTTGAGCTGCAGCTGGCTCGG - Intronic
1010490968 6:76476376-76476398 GCACTGGGCTGCAGCTGATCAGG - Intergenic
1014925653 6:127267111-127267133 CCCTTGGGCTGGCGCGGCCCCGG + Intronic
1017598004 6:156050232-156050254 GACTTGGGCAGCTGCTTCCCAGG + Intergenic
1017837952 6:158197008-158197030 GCTTTTGTCTGCAGCTGACCTGG - Exonic
1018934584 6:168265419-168265441 GCCCTGGTCTGCTGATGCCCAGG - Intergenic
1019104398 6:169656721-169656743 GCATTAGGCCGCAGCAGCCCAGG + Intronic
1019129496 6:169863189-169863211 GCCTTTGCCTGGAGCTGCTCTGG + Intergenic
1019274179 7:167199-167221 TCCTGAGGCTGCAGCTGCCCTGG + Intergenic
1019443907 7:1061082-1061104 GCACTGGGCTGCCTCTGCCCGGG + Intronic
1019913761 7:4117581-4117603 GGCTGGTGCCGCAGCTGCCCTGG + Intronic
1020435323 7:8156098-8156120 ACCTTGTGCTGCACCTGACCTGG - Intronic
1020567592 7:9817547-9817569 GCCTTTGGCCCCTGCTGCCCTGG + Intergenic
1021424698 7:20486708-20486730 GCCCTGTGCTGCAGCTGCTTGGG - Intergenic
1021694919 7:23267185-23267207 GCCTGGGGCTGCGTCTACCCAGG + Intronic
1022468637 7:30668026-30668048 CCCTCGGGCTGCTGCTGCCTGGG + Intronic
1022474378 7:30700331-30700353 GCCCGGGGCTGTAGCTCCCCAGG + Intronic
1022482241 7:30751909-30751931 AGCTGGGGCTGCAGCCGCCCTGG - Intronic
1022496274 7:30854987-30855009 GCCTGGGGCTCCCGATGCCCCGG - Intronic
1022504613 7:30902541-30902563 CCCTGGGGCTGCAGCTCCTCAGG - Intergenic
1022530544 7:31064213-31064235 TCCTTAGCCTGCAGCTGCCGGGG + Intronic
1024181675 7:46901431-46901453 GTCTTTGGCTGGAGCAGCCCTGG - Intergenic
1024801757 7:53087443-53087465 GGCCTGGGCTGCAGGTGCCTGGG + Intergenic
1025777369 7:64570546-64570568 GCCTGCGGCTGCACCGGCCCGGG + Intergenic
1025991731 7:66502738-66502760 GCCAGGGGCTGCTGCTGCCTGGG + Intergenic
1026390077 7:69892022-69892044 GCCTTGTGATCCATCTGCCCTGG + Intronic
1026580926 7:71615950-71615972 GCCTTGTGCTACACCTGCCCTGG - Intronic
1026999607 7:74643420-74643442 CCATAGGGCGGCAGCTGCCCAGG + Intergenic
1027937891 7:84632634-84632656 GCCTTGGGTAGCATCTCCCCTGG - Intergenic
1028762533 7:94510596-94510618 GCCTTGGGCTTCATGCGCCCCGG - Intronic
1031981635 7:128130771-128130793 TCCTTGTCCTGCAGCAGCCCTGG - Intergenic
1032068801 7:128791524-128791546 GCCGCGGGCTGGAGCTGCCCGGG + Intronic
1032944106 7:136830115-136830137 GCCTTTGGCTGCAGCTGATTCGG - Intergenic
1033552299 7:142458507-142458529 GCCTTGGGTTACAGCTGAACAGG - Intergenic
1033559190 7:142515011-142515033 GCCTTGGGTTACAGCTGAACAGG - Intergenic
1033733727 7:144202186-144202208 GCCATGGGCTTCAGCTTGCCTGG + Intergenic
1033749323 7:144348787-144348809 GCCATGGGCTTCAGCTTGCCTGG - Intergenic
1033756963 7:144403796-144403818 GCCTCGGGCTACGGCTCCCCCGG - Intronic
1034271050 7:149803584-149803606 ACCATTGGCTGCAGTTGCCCAGG - Intergenic
1034531136 7:151697098-151697120 GCCTTGGGCGGGAGCATCCCCGG + Intronic
1034966602 7:155395223-155395245 GCCTCGGGCTGCTGCAGCTCAGG + Exonic
1035220892 7:157406016-157406038 TCCTCCTGCTGCAGCTGCCCTGG - Intronic
1035234458 7:157487447-157487469 GCCATGGGCTGCAGGCTCCCTGG - Intergenic
1035360851 7:158313450-158313472 GCAGAGGGCTCCAGCTGCCCAGG + Intronic
1035368871 7:158366042-158366064 GCATTGGGCTGCAGCTTCTAGGG - Intronic
1035368875 7:158366100-158366122 GCATTGGGCTGCAGCTTCTAGGG - Intronic
1035368889 7:158366219-158366241 GCATTGGGCTGCAGCTTCTAGGG - Intronic
1035681082 8:1488555-1488577 GAGGTGGGCTGCAGCTGCCCAGG + Intergenic
1036451360 8:8870765-8870787 TCCCTGGACTGCAGCTTCCCGGG + Intronic
1036749926 8:11437104-11437126 GCTTTGGGCTTCAGCTGCCAGGG + Intronic
1036910360 8:12754024-12754046 GGCTTGGGGCGGAGCTGCCCAGG - Intronic
1037589757 8:20303127-20303149 CCCTGGGGCTGCAGCTTCCTGGG - Intronic
1037883845 8:22586049-22586071 GCCCTGGGCCGCAGCTGCTGGGG + Intronic
1037890000 8:22619022-22619044 GCCTGGGGCTGCAGCCACCATGG + Intronic
1038154216 8:24972487-24972509 ACATTGGGGTGCAGCTGCCCTGG - Intergenic
1039567200 8:38560079-38560101 CCCGTCGGCTGCAGCTTCCCTGG + Intergenic
1039869459 8:41533343-41533365 GCCTGGGGCTCCAGCTGTCCTGG - Intronic
1043219672 8:77644853-77644875 GACTTTGGCTGGAGCTGCCCAGG - Intergenic
1044436561 8:92171086-92171108 TCCTTGGGCTGCAGCTGGCTGGG + Intergenic
1047410205 8:124618221-124618243 CTCTTAGGCTGCTGCTGCCCAGG + Intronic
1047429538 8:124779129-124779151 GCCTGTGGCTCCAGCTGCTCGGG + Intergenic
1048486120 8:134849171-134849193 GCTGTGACCTGCAGCTGCCCTGG - Intergenic
1049014178 8:139908019-139908041 ACCCTGGGCTGGTGCTGCCCTGG - Intronic
1049240187 8:141533811-141533833 GCCTTGGGATGGAGCTGTGCAGG + Intergenic
1049364114 8:142228363-142228385 GCCCTGGGCTGCAGCCGGGCAGG - Intronic
1049432886 8:142573511-142573533 GCCTGGGGCTGCACCTGCAGGGG - Intergenic
1049578139 8:143398900-143398922 GCCCGGCACTGCAGCTGCCCTGG + Intergenic
1049604890 8:143524733-143524755 GCCCTGGCCTTCAGCTCCCCGGG + Intronic
1049654815 8:143792837-143792859 GCCTGGGCCTGCAGCCTCCCCGG - Exonic
1050602497 9:7266959-7266981 GGCTTGGGCAGCAGGTGCCTGGG + Intergenic
1053146829 9:35717735-35717757 GGCAAGTGCTGCAGCTGCCCTGG - Exonic
1053270665 9:36747256-36747278 GCTTTGGGGTCCAGCTGACCTGG + Intergenic
1053442483 9:38127722-38127744 GCCTGGGGCTTCAGCTTTCCAGG + Intergenic
1054801428 9:69353172-69353194 GCCTTGGGGTGCAGGAGTCCCGG - Intronic
1056659939 9:88535948-88535970 CCCTTGGGGTGCCGATGCCCTGG - Intronic
1056706109 9:88953867-88953889 GCCCTGGGACCCAGCTGCCCTGG - Intergenic
1057020933 9:91697341-91697363 GCCCTGGGCTGCAGGTCCTCTGG - Intronic
1057188478 9:93072397-93072419 GCATTTGGCTGCAGCTGGCCAGG - Intronic
1057274200 9:93667610-93667632 GTCGGGGGCTGCAGCTGCCATGG + Intronic
1057630058 9:96712470-96712492 GCCTGTGGTTGCAGCTACCCAGG + Intergenic
1057791368 9:98127281-98127303 GCCTTGGGGGGCAGCGGACCAGG - Intronic
1059404807 9:114093081-114093103 GCCTAGGGCTCCCTCTGCCCTGG - Intronic
1059471117 9:114505377-114505399 GCCCCGGGATGCAGCCGCCCGGG + Intronic
1060533101 9:124360378-124360400 GGCCTGGGCAGCATCTGCCCGGG + Intronic
1060587367 9:124795015-124795037 ACCATGGACTGCAGCTGCCCGGG - Exonic
1060811723 9:126614240-126614262 GGCGCGGGCTGCAGCCGCCCCGG + Intergenic
1061391642 9:130320278-130320300 CCCATGGGCTCCAGCTCCCCAGG - Intronic
1061912219 9:133731311-133731333 TCCTCGGGCAGAAGCTGCCCTGG + Exonic
1062013016 9:134276951-134276973 GCCTTGGGCTCCGGATGCCGTGG + Intergenic
1062198333 9:135287031-135287053 CCCTTGGGCCGGAGCTGCTCTGG - Intergenic
1062218000 9:135399516-135399538 GGCTTGGCGTGCAGATGCCCAGG + Intergenic
1062379542 9:136280668-136280690 GCCTTGGGCTGGAGCCCTCCTGG - Intergenic
1062382535 9:136294438-136294460 GCCACGGGGTGGAGCTGCCCTGG - Intronic
1062516759 9:136940720-136940742 GCCTTGGGCTCCATCTGCACTGG + Exonic
1062656299 9:137605859-137605881 GCCTTTGGCCGCACCTGCGCGGG + Intronic
1187391907 X:18891647-18891669 TCCACGGGCTGCAGCTTCCCAGG - Intergenic
1189726892 X:43976129-43976151 GCCTGGGGCTCCAGCTTTCCTGG + Intergenic
1195159053 X:102154133-102154155 GGTTTGGGCTCCACCTGCCCCGG - Exonic
1195349078 X:103979986-103980008 GGGATGGGCTGCAGCAGCCCAGG - Intergenic
1195351056 X:103997333-103997355 GGGATGGGCTGCAGCAGCCCAGG + Intergenic
1195352648 X:104009483-104009505 GGGATGGGCTGCAGCAGCCCAGG + Intergenic
1195356446 X:104044079-104044101 GGGATGGGCTGCAGCAGCCCAGG - Intergenic
1195358365 X:104058853-104058875 GGGATGGGCTGCAGCAGCCCAGG + Intergenic
1197709335 X:129654636-129654658 TCCTTGGGCCGCCGCGGCCCCGG + Exonic
1198209423 X:134503120-134503142 GCCTTGCTCTGCTGCTGCCCAGG + Intronic
1200108494 X:153726978-153727000 GCCTGGGGTTGCAGCTGCCTTGG + Intronic
1200963310 Y:9014418-9014440 TCCTTGGGCTGCTGCTGCTTGGG - Intergenic