ID: 913194504

View in Genome Browser
Species Human (GRCh38)
Location 1:116444511-116444533
Sequence TCTACCAGAAAGTACTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913194500_913194504 1 Left 913194500 1:116444487-116444509 CCTTGCTCAGAAGAACCTGGGGC No data
Right 913194504 1:116444511-116444533 TCTACCAGAAAGTACTAGGAGGG No data
913194494_913194504 27 Left 913194494 1:116444461-116444483 CCTCAGTCCAGATAGAACAAGGG No data
Right 913194504 1:116444511-116444533 TCTACCAGAAAGTACTAGGAGGG No data
913194496_913194504 20 Left 913194496 1:116444468-116444490 CCAGATAGAACAAGGGCAGCCTT No data
Right 913194504 1:116444511-116444533 TCTACCAGAAAGTACTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913194504 Original CRISPR TCTACCAGAAAGTACTAGGA GGG Intergenic
No off target data available for this crispr