ID: 913195199

View in Genome Browser
Species Human (GRCh38)
Location 1:116450532-116450554
Sequence ACGAAGTACCACTATGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913195199_913195203 26 Left 913195199 1:116450532-116450554 CCCACCTCATAGTGGTACTTCGT No data
Right 913195203 1:116450581-116450603 AGTGCTTACCAGTGACTGGCAGG No data
913195199_913195202 22 Left 913195199 1:116450532-116450554 CCCACCTCATAGTGGTACTTCGT No data
Right 913195202 1:116450577-116450599 GCAGAGTGCTTACCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913195199 Original CRISPR ACGAAGTACCACTATGAGGT GGG (reversed) Intergenic
No off target data available for this crispr