ID: 913195200

View in Genome Browser
Species Human (GRCh38)
Location 1:116450533-116450555
Sequence CACGAAGTACCACTATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913195200_913195203 25 Left 913195200 1:116450533-116450555 CCACCTCATAGTGGTACTTCGTG No data
Right 913195203 1:116450581-116450603 AGTGCTTACCAGTGACTGGCAGG No data
913195200_913195202 21 Left 913195200 1:116450533-116450555 CCACCTCATAGTGGTACTTCGTG No data
Right 913195202 1:116450577-116450599 GCAGAGTGCTTACCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913195200 Original CRISPR CACGAAGTACCACTATGAGG TGG (reversed) Intergenic
No off target data available for this crispr