ID: 913195201

View in Genome Browser
Species Human (GRCh38)
Location 1:116450536-116450558
Sequence ATTCACGAAGTACCACTATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913195201_913195202 18 Left 913195201 1:116450536-116450558 CCTCATAGTGGTACTTCGTGAAT No data
Right 913195202 1:116450577-116450599 GCAGAGTGCTTACCAGTGACTGG No data
913195201_913195203 22 Left 913195201 1:116450536-116450558 CCTCATAGTGGTACTTCGTGAAT No data
Right 913195203 1:116450581-116450603 AGTGCTTACCAGTGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913195201 Original CRISPR ATTCACGAAGTACCACTATG AGG (reversed) Intergenic
No off target data available for this crispr