ID: 913195202

View in Genome Browser
Species Human (GRCh38)
Location 1:116450577-116450599
Sequence GCAGAGTGCTTACCAGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913195200_913195202 21 Left 913195200 1:116450533-116450555 CCACCTCATAGTGGTACTTCGTG No data
Right 913195202 1:116450577-116450599 GCAGAGTGCTTACCAGTGACTGG No data
913195199_913195202 22 Left 913195199 1:116450532-116450554 CCCACCTCATAGTGGTACTTCGT No data
Right 913195202 1:116450577-116450599 GCAGAGTGCTTACCAGTGACTGG No data
913195201_913195202 18 Left 913195201 1:116450536-116450558 CCTCATAGTGGTACTTCGTGAAT No data
Right 913195202 1:116450577-116450599 GCAGAGTGCTTACCAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913195202 Original CRISPR GCAGAGTGCTTACCAGTGAC TGG Intergenic
No off target data available for this crispr