ID: 913195203

View in Genome Browser
Species Human (GRCh38)
Location 1:116450581-116450603
Sequence AGTGCTTACCAGTGACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913195200_913195203 25 Left 913195200 1:116450533-116450555 CCACCTCATAGTGGTACTTCGTG No data
Right 913195203 1:116450581-116450603 AGTGCTTACCAGTGACTGGCAGG No data
913195199_913195203 26 Left 913195199 1:116450532-116450554 CCCACCTCATAGTGGTACTTCGT No data
Right 913195203 1:116450581-116450603 AGTGCTTACCAGTGACTGGCAGG No data
913195201_913195203 22 Left 913195201 1:116450536-116450558 CCTCATAGTGGTACTTCGTGAAT No data
Right 913195203 1:116450581-116450603 AGTGCTTACCAGTGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913195203 Original CRISPR AGTGCTTACCAGTGACTGGC AGG Intergenic
No off target data available for this crispr