ID: 913195854

View in Genome Browser
Species Human (GRCh38)
Location 1:116455372-116455394
Sequence CTCCCTCTCCACCTCCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913195845_913195854 9 Left 913195845 1:116455340-116455362 CCTCCCGCCCACCCTCAGCATAC No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data
913195847_913195854 5 Left 913195847 1:116455344-116455366 CCGCCCACCCTCAGCATACAGAT No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data
913195843_913195854 14 Left 913195843 1:116455335-116455357 CCTTCCCTCCCGCCCACCCTCAG No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data
913195849_913195854 1 Left 913195849 1:116455348-116455370 CCACCCTCAGCATACAGATACAC No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data
913195844_913195854 10 Left 913195844 1:116455339-116455361 CCCTCCCGCCCACCCTCAGCATA No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data
913195842_913195854 17 Left 913195842 1:116455332-116455354 CCTCCTTCCCTCCCGCCCACCCT No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data
913195846_913195854 6 Left 913195846 1:116455343-116455365 CCCGCCCACCCTCAGCATACAGA No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data
913195851_913195854 -3 Left 913195851 1:116455352-116455374 CCTCAGCATACAGATACACCCTC No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data
913195850_913195854 -2 Left 913195850 1:116455351-116455373 CCCTCAGCATACAGATACACCCT No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data
913195848_913195854 2 Left 913195848 1:116455347-116455369 CCCACCCTCAGCATACAGATACA No data
Right 913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913195854 Original CRISPR CTCCCTCTCCACCTCCGTGC TGG Intergenic