ID: 913195869

View in Genome Browser
Species Human (GRCh38)
Location 1:116455424-116455446
Sequence AGGCAGCCAGGTCCCCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913195869_913195876 9 Left 913195869 1:116455424-116455446 CCCACATGGGGACCTGGCTGCCT No data
Right 913195876 1:116455456-116455478 CCACCCCACACTGCCTCCCATGG No data
913195869_913195877 10 Left 913195869 1:116455424-116455446 CCCACATGGGGACCTGGCTGCCT No data
Right 913195877 1:116455457-116455479 CACCCCACACTGCCTCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913195869 Original CRISPR AGGCAGCCAGGTCCCCATGT GGG (reversed) Intergenic
No off target data available for this crispr