ID: 913199001

View in Genome Browser
Species Human (GRCh38)
Location 1:116481394-116481416
Sequence TAGCCTCCACCCACCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913198992_913199001 27 Left 913198992 1:116481344-116481366 CCAATGTGACCACTACAGGAATG No data
Right 913199001 1:116481394-116481416 TAGCCTCCACCCACCCATGCAGG No data
913198994_913199001 18 Left 913198994 1:116481353-116481375 CCACTACAGGAATGGCGTCCAAG No data
Right 913199001 1:116481394-116481416 TAGCCTCCACCCACCCATGCAGG No data
913198998_913199001 0 Left 913198998 1:116481371-116481393 CCAAGGGGCTCACCAGAGCATCC No data
Right 913199001 1:116481394-116481416 TAGCCTCCACCCACCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913199001 Original CRISPR TAGCCTCCACCCACCCATGC AGG Intergenic
No off target data available for this crispr