ID: 913199316

View in Genome Browser
Species Human (GRCh38)
Location 1:116483410-116483432
Sequence TCCAAAGGCAAACTTCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913199316_913199322 5 Left 913199316 1:116483410-116483432 CCCATGAGAAGTTTGCCTTTGGA No data
Right 913199322 1:116483438-116483460 CCATTAACTCCTTCCTAACAGGG No data
913199316_913199320 4 Left 913199316 1:116483410-116483432 CCCATGAGAAGTTTGCCTTTGGA No data
Right 913199320 1:116483437-116483459 CCCATTAACTCCTTCCTAACAGG No data
913199316_913199325 19 Left 913199316 1:116483410-116483432 CCCATGAGAAGTTTGCCTTTGGA No data
Right 913199325 1:116483452-116483474 CTAACAGGGTGACAGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913199316 Original CRISPR TCCAAAGGCAAACTTCTCAT GGG (reversed) Intergenic
No off target data available for this crispr