ID: 913199317

View in Genome Browser
Species Human (GRCh38)
Location 1:116483411-116483433
Sequence TTCCAAAGGCAAACTTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913199317_913199320 3 Left 913199317 1:116483411-116483433 CCATGAGAAGTTTGCCTTTGGAA No data
Right 913199320 1:116483437-116483459 CCCATTAACTCCTTCCTAACAGG No data
913199317_913199322 4 Left 913199317 1:116483411-116483433 CCATGAGAAGTTTGCCTTTGGAA No data
Right 913199322 1:116483438-116483460 CCATTAACTCCTTCCTAACAGGG No data
913199317_913199325 18 Left 913199317 1:116483411-116483433 CCATGAGAAGTTTGCCTTTGGAA No data
Right 913199325 1:116483452-116483474 CTAACAGGGTGACAGAGAGCTGG No data
913199317_913199326 30 Left 913199317 1:116483411-116483433 CCATGAGAAGTTTGCCTTTGGAA No data
Right 913199326 1:116483464-116483486 CAGAGAGCTGGTGCCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913199317 Original CRISPR TTCCAAAGGCAAACTTCTCA TGG (reversed) Intergenic
No off target data available for this crispr