ID: 913199320

View in Genome Browser
Species Human (GRCh38)
Location 1:116483437-116483459
Sequence CCCATTAACTCCTTCCTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913199317_913199320 3 Left 913199317 1:116483411-116483433 CCATGAGAAGTTTGCCTTTGGAA No data
Right 913199320 1:116483437-116483459 CCCATTAACTCCTTCCTAACAGG No data
913199316_913199320 4 Left 913199316 1:116483410-116483432 CCCATGAGAAGTTTGCCTTTGGA No data
Right 913199320 1:116483437-116483459 CCCATTAACTCCTTCCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913199320 Original CRISPR CCCATTAACTCCTTCCTAAC AGG Intergenic
No off target data available for this crispr