ID: 913199366

View in Genome Browser
Species Human (GRCh38)
Location 1:116483710-116483732
Sequence TGATGGCCACACTGAGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913199362_913199366 -5 Left 913199362 1:116483692-116483714 CCTGGCAGAAGGCCAGGATGATG No data
Right 913199366 1:116483710-116483732 TGATGGCCACACTGAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913199366 Original CRISPR TGATGGCCACACTGAGTGCT GGG Intergenic
No off target data available for this crispr