ID: 913202014

View in Genome Browser
Species Human (GRCh38)
Location 1:116502656-116502678
Sequence GCCCCTTTCTCAGAAGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913202014_913202033 29 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202033 1:116502708-116502730 GCAAGAGTGGGGCAGGGGGCAGG No data
913202014_913202020 -4 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202020 1:116502675-116502697 GGGCAAGAGGGGAGGAAGCACGG No data
913202014_913202032 25 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202032 1:116502704-116502726 CAGGGCAAGAGTGGGGCAGGGGG No data
913202014_913202022 6 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202022 1:116502685-116502707 GGAGGAAGCACGGGTTTCCCAGG No data
913202014_913202025 17 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202025 1:116502696-116502718 GGGTTTCCCAGGGCAAGAGTGGG No data
913202014_913202023 7 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202023 1:116502686-116502708 GAGGAAGCACGGGTTTCCCAGGG No data
913202014_913202031 24 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202031 1:116502703-116502725 CCAGGGCAAGAGTGGGGCAGGGG No data
913202014_913202021 -3 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202021 1:116502676-116502698 GGCAAGAGGGGAGGAAGCACGGG No data
913202014_913202027 22 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202027 1:116502701-116502723 TCCCAGGGCAAGAGTGGGGCAGG No data
913202014_913202024 16 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202024 1:116502695-116502717 CGGGTTTCCCAGGGCAAGAGTGG No data
913202014_913202029 23 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202029 1:116502702-116502724 CCCAGGGCAAGAGTGGGGCAGGG No data
913202014_913202034 30 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202034 1:116502709-116502731 CAAGAGTGGGGCAGGGGGCAGGG No data
913202014_913202026 18 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202026 1:116502697-116502719 GGTTTCCCAGGGCAAGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913202014 Original CRISPR GCCCCTTTCTCAGAAGCAGG CGG (reversed) Intergenic
No off target data available for this crispr