ID: 913202015

View in Genome Browser
Species Human (GRCh38)
Location 1:116502659-116502681
Sequence CTTGCCCCTTTCTCAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913202015_913202022 3 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202022 1:116502685-116502707 GGAGGAAGCACGGGTTTCCCAGG No data
913202015_913202032 22 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202032 1:116502704-116502726 CAGGGCAAGAGTGGGGCAGGGGG No data
913202015_913202034 27 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202034 1:116502709-116502731 CAAGAGTGGGGCAGGGGGCAGGG No data
913202015_913202023 4 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202023 1:116502686-116502708 GAGGAAGCACGGGTTTCCCAGGG No data
913202015_913202026 15 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202026 1:116502697-116502719 GGTTTCCCAGGGCAAGAGTGGGG No data
913202015_913202027 19 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202027 1:116502701-116502723 TCCCAGGGCAAGAGTGGGGCAGG No data
913202015_913202021 -6 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202021 1:116502676-116502698 GGCAAGAGGGGAGGAAGCACGGG No data
913202015_913202025 14 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202025 1:116502696-116502718 GGGTTTCCCAGGGCAAGAGTGGG No data
913202015_913202029 20 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202029 1:116502702-116502724 CCCAGGGCAAGAGTGGGGCAGGG No data
913202015_913202035 28 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202035 1:116502710-116502732 AAGAGTGGGGCAGGGGGCAGGGG No data
913202015_913202033 26 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202033 1:116502708-116502730 GCAAGAGTGGGGCAGGGGGCAGG No data
913202015_913202031 21 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202031 1:116502703-116502725 CCAGGGCAAGAGTGGGGCAGGGG No data
913202015_913202020 -7 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202020 1:116502675-116502697 GGGCAAGAGGGGAGGAAGCACGG No data
913202015_913202024 13 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202024 1:116502695-116502717 CGGGTTTCCCAGGGCAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913202015 Original CRISPR CTTGCCCCTTTCTCAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr