ID: 913202027

View in Genome Browser
Species Human (GRCh38)
Location 1:116502701-116502723
Sequence TCCCAGGGCAAGAGTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913202015_913202027 19 Left 913202015 1:116502659-116502681 CCTGCTTCTGAGAAAGGGGCAAG No data
Right 913202027 1:116502701-116502723 TCCCAGGGCAAGAGTGGGGCAGG No data
913202014_913202027 22 Left 913202014 1:116502656-116502678 CCGCCTGCTTCTGAGAAAGGGGC No data
Right 913202027 1:116502701-116502723 TCCCAGGGCAAGAGTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913202027 Original CRISPR TCCCAGGGCAAGAGTGGGGC AGG Intergenic
No off target data available for this crispr