ID: 913203507

View in Genome Browser
Species Human (GRCh38)
Location 1:116515332-116515354
Sequence CAGACCACGGGGGAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913203507_913203515 9 Left 913203507 1:116515332-116515354 CCGGCCTCCTCCCCCGTGGTCTG No data
Right 913203515 1:116515364-116515386 ACAGAGCTCAAAATCAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913203507 Original CRISPR CAGACCACGGGGGAGGAGGC CGG (reversed) Intronic
No off target data available for this crispr