ID: 913205526

View in Genome Browser
Species Human (GRCh38)
Location 1:116534637-116534659
Sequence CAGCGCCGCCGCGGCGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 1, 2: 4, 3: 54, 4: 417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913205526_913205530 -8 Left 913205526 1:116534637-116534659 CCAGGCCCGCCGCGGCGGCGCTG 0: 1
1: 1
2: 4
3: 54
4: 417
Right 913205530 1:116534652-116534674 CGGCGCTGCCCACCCTGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913205526 Original CRISPR CAGCGCCGCCGCGGCGGGCC TGG (reversed) Intronic
900110082 1:1001666-1001688 CAGGGGCACCGCGGAGGGCCGGG - Intergenic
900121782 1:1051394-1051416 CAGGGCCTCCGGGGCGGGCGGGG + Intronic
900349567 1:2228214-2228236 CAGCGCCGCCGGGACGAGCCGGG + Intergenic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
900694178 1:3999920-3999942 CACTGCCGACGGGGCGGGCCTGG + Intergenic
901019757 1:6249699-6249721 CCGCGCCGCCGCCCCGGGCCCGG - Exonic
903153269 1:21428165-21428187 CCGCGCCGCTGCGGGCGGCCTGG + Intergenic
903184706 1:21622524-21622546 CAGCGCCGCCGCCGGGAGCCGGG - Intronic
903555124 1:24187416-24187438 CAGCCCCGCCGCGGGGGGAGGGG + Intronic
904160426 1:28518614-28518636 CTGCGCGAGCGCGGCGGGCCGGG + Intronic
904642008 1:31938133-31938155 CGCCGCCGCCGGGCCGGGCCGGG - Exonic
904762699 1:32817301-32817323 CACCGTCGCCGCCGCGTGCCGGG + Exonic
905639146 1:39576585-39576607 AAGCGCTGCGGCGGCGGGCGCGG + Intronic
905648285 1:39639704-39639726 CGGCGCCCCCGAGGCGGGGCCGG - Exonic
906532827 1:46533227-46533249 CTCGGCGGCCGCGGCGGGCCCGG - Intergenic
906637010 1:47416484-47416506 CGCCGCCGCCGCCCCGGGCCGGG - Exonic
907136254 1:52142160-52142182 GAGCGCCGCCGAGCCGGGCCGGG - Exonic
909001412 1:70221673-70221695 CCGGGCCCCAGCGGCGGGCCCGG + Exonic
913144511 1:115976479-115976501 CGGCGGGGCCGGGGCGGGCCGGG - Exonic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
913453561 1:119008432-119008454 CTGGCCCGGCGCGGCGGGCCAGG + Intergenic
915200120 1:154221018-154221040 CAGCGGCAGCGCGGCGGGGCCGG + Intronic
916106991 1:161440256-161440278 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916108552 1:161447670-161447692 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916110140 1:161455051-161455073 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916111725 1:161462461-161462483 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916113312 1:161469842-161469864 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916233343 1:162561653-162561675 CCGCGGCGGCGGGGCGGGCCGGG - Exonic
916414036 1:164576388-164576410 CGGCGCCGCGCCGGCGGACCGGG - Intronic
917369096 1:174269232-174269254 CTGCGCCACCGCGCCCGGCCAGG + Intronic
919463239 1:197902935-197902957 CGGGGCGGCCGCGGCGGGGCGGG - Intronic
919463241 1:197902936-197902958 CCGCCCCGCCGCGGCCGCCCCGG + Intronic
921046105 1:211479072-211479094 CACCGCCGCCACTGCGGTCCTGG - Exonic
922739343 1:228006816-228006838 CAACGCCGCCGCCGCGGTTCGGG + Intergenic
922775438 1:228212362-228212384 CAGCGCCGCCGCGGCGCTAGTGG + Exonic
923056063 1:230426411-230426433 CAGCTCCCCCGCGGCTGTCCGGG - Intergenic
923171494 1:231421622-231421644 CAGTGCCGCCGCCCAGGGCCGGG - Exonic
924527065 1:244863030-244863052 GAGCGCCGCCGCGCCGGGCTCGG - Intronic
1062874108 10:931543-931565 CGGCGCGGCCGGGCCGGGCCGGG + Exonic
1064208966 10:13347770-13347792 CGCCGCCGCCGCGCGGGGCCGGG - Intronic
1065099500 10:22320554-22320576 CAGGGGCTCCGCGCCGGGCCGGG - Intronic
1065215004 10:23439923-23439945 GAGCCCCGCCGCGGCGGGACCGG - Exonic
1066464504 10:35640787-35640809 CACCGCCGCCGCCGCGAGCTGGG + Exonic
1069705738 10:70458334-70458356 CCGCCCCGCCGCGCCTGGCCGGG + Intergenic
1070305349 10:75235881-75235903 CAGGGCCAGCGCGGCGGGCACGG + Exonic
1070327638 10:75398982-75399004 CAGCGCTGCCGCGGCCGCCATGG - Exonic
1070786627 10:79165831-79165853 CAGCTCCCCCTAGGCGGGCCTGG + Intronic
1070948019 10:80408909-80408931 CGGCGCTGCTGCGGCGGGCTAGG + Intronic
1071086563 10:81874311-81874333 CAGAATCGCCGCGGCGGGCTGGG - Intergenic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1072294177 10:93993821-93993843 TAGCGCCACCGCGGGCGGCCGGG - Intergenic
1072591627 10:96832728-96832750 CGGCGCCGGGGCGCCGGGCCTGG - Intronic
1072638886 10:97196236-97196258 CTGCCCCGACGCCGCGGGCCGGG - Intronic
1072656565 10:97334294-97334316 CAGCGGCACCGCCGGGGGCCGGG + Exonic
1073059379 10:100724344-100724366 CTGAGCCGCCGAGGCCGGCCGGG - Intergenic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1074866417 10:117546667-117546689 CACCGCCGCCTCGGCTGTCCAGG - Intronic
1074884770 10:117685084-117685106 CAGCGCCCCCGTGTCTGGCCTGG - Intergenic
1075031902 10:119029641-119029663 CAGGGCCGCGGCGGCGAGGCCGG + Intergenic
1075054625 10:119207995-119208017 CGGCGCGTCCGCCGCGGGCCAGG + Intronic
1075748568 10:124744526-124744548 CCGCGCCACCGCGGCTGCCCGGG + Intronic
1076650329 10:131982546-131982568 CAGGGGCGCCCCGGCGGGGCGGG - Intergenic
1076707031 10:132307785-132307807 CAGCAGCGCCGCGGCGTCCCCGG - Exonic
1076792811 10:132785949-132785971 GGGCGCCGCCGCCGCCGGCCCGG + Exonic
1077101262 11:823637-823659 CAGCGCGGCCGCGGCCCGCAGGG - Intronic
1077962461 11:7089624-7089646 CACCGCCGCTGCTGCGAGCCGGG - Exonic
1079689409 11:23403540-23403562 CGCCGCCGCCGCCGCGGGACGGG + Intergenic
1080802139 11:35618783-35618805 CGGGGCCGCCGCTCCGGGCCGGG - Exonic
1081705480 11:45180413-45180435 CAGCGCCGCGGAGGCCGGGCGGG - Intronic
1082848013 11:57741752-57741774 CAGTGGCGCCGGGGGGGGCCAGG + Intronic
1083221745 11:61257273-61257295 CTGAGCCACCGCGCCGGGCCGGG - Intergenic
1083272832 11:61580765-61580787 AAGCGCGGCCCCGGCGGGCTGGG - Intronic
1083335147 11:61917665-61917687 CTGTCCCGGCGCGGCGGGCCGGG - Intronic
1083659757 11:64246643-64246665 CAGCGGCACCGCGGGGGGCGCGG - Exonic
1083670865 11:64299413-64299435 CGGCGGCGGGGCGGCGGGCCCGG - Exonic
1084310373 11:68312999-68313021 CAGCGTCCCCGGGGAGGGCCCGG - Intronic
1084538987 11:69775052-69775074 CAGCGCTACCGCGGCCGTCCCGG + Exonic
1084620954 11:70270233-70270255 TAGGGGCGCCGCGGCGGGCGGGG + Intergenic
1084888117 11:72223827-72223849 CCGCGCCGCCCCGGGGAGCCGGG - Intronic
1085208099 11:74749162-74749184 CGCCGCCGACGCGGCGGGCCCGG + Exonic
1085232961 11:74988818-74988840 CAGCGCCGAGGGGGCGGGACGGG + Exonic
1085346027 11:75768711-75768733 AGGCGCCGACGCGGCGGGCGGGG - Exonic
1089729555 11:120511819-120511841 CAGCAGCCCCGCGGCCGGCCCGG + Exonic
1090293887 11:125569548-125569570 CAGCTCCGCCGCCGCGGCTCCGG - Exonic
1091564618 12:1639417-1639439 CTGAGCCACCGCGCCGGGCCAGG + Intronic
1091688993 12:2583141-2583163 GCGCGGCGCCGCTGCGGGCCCGG - Intronic
1091740767 12:2959261-2959283 CCGGGCCGCCGGGGCGGGGCGGG - Intergenic
1091740831 12:2959460-2959482 CGGCGCCGCCGCGTCCCGCCAGG + Exonic
1091915368 12:4269325-4269347 CGGCGGCGGCGCGGCGGGTCTGG - Intergenic
1092429378 12:8396830-8396852 CACCGCCACCACGCCGGGCCCGG + Intergenic
1094682685 12:32679689-32679711 CGGAGCCGGCGCGGCGGGCCTGG + Intronic
1096840926 12:54378978-54379000 CAGCCCCGCAGGGGCGGGCGGGG + Intronic
1101682902 12:106986905-106986927 CAGCGGCGCCGCAGCGGTCAGGG - Exonic
1101750870 12:107581400-107581422 CAGCGCCGCCGAGGTGTGCGGGG - Intronic
1101970639 12:109309808-109309830 CCTCGCCGCCGCGCTGGGCCCGG - Intergenic
1102197418 12:111034878-111034900 CAGAGCCGCCGCCGCCGGACTGG + Intronic
1102558183 12:113742587-113742609 CAGCGCCGCTGCTGCTGCCCAGG - Intergenic
1102884075 12:116508534-116508556 CAGAGCCGCGGCGGCGCGGCGGG - Intergenic
1103415959 12:120741600-120741622 CAGCGCTGCCTCGCCGGGCGGGG - Intergenic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1103779396 12:123389107-123389129 CAGCGCCGCCGCGGCGCCCCGGG - Intronic
1103954250 12:124567588-124567610 CACCGCCGCCGCGGCCGCCGGGG - Intronic
1104624314 12:130339080-130339102 CAGCGCAGCGGCGGCGGACGCGG - Intronic
1105000646 12:132687830-132687852 CCGCGCCGCTGCGGCCGACCTGG - Intronic
1107058405 13:36130920-36130942 CAACGCCCCCGGGTCGGGCCAGG + Intronic
1112091628 13:96090230-96090252 CAGCGCAGCGGCAGCGGGCGAGG - Intergenic
1112652759 13:101416509-101416531 GAGCGCCGCCGCCGCCGGGCAGG + Intergenic
1113737774 13:112690364-112690386 CAGCGCCCCCGCGCCCGGCTCGG - Exonic
1113758738 13:112832984-112833006 CAGCGCCACCTCGTCGGGCGAGG - Exonic
1113820278 13:113208730-113208752 CTGCGCACCCGCGGCGGGGCCGG - Intronic
1114633274 14:24172945-24172967 AAGCGGGGCCGCGGCAGGCCGGG - Exonic
1115851789 14:37595150-37595172 CGGCGGCGGCGCGGCGGGCGGGG + Intronic
1116973877 14:51095025-51095047 CACAGCCGCCGCCGCTGGCCAGG - Exonic
1117680682 14:58200082-58200104 TCGCGCGGCCGCGGCGCGCCGGG - Intronic
1117875868 14:60249550-60249572 CACCGCTGCAGCGGCGGGCCAGG - Intronic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118776952 14:68979189-68979211 CAGCAGCGCCGCGGCGGAACCGG - Exonic
1121074946 14:91060285-91060307 GCGCGCCCCCGCGCCGGGCCCGG + Intronic
1122359529 14:101151254-101151276 CAGGGAGGCCGCGGCAGGCCTGG + Intergenic
1122543350 14:102509655-102509677 GAGCGCGGCTGCGGCGGGCGCGG - Exonic
1122775998 14:104117179-104117201 CAGCGAGGACGCGGCGGGGCTGG + Intergenic
1122905749 14:104800758-104800780 CAGCGCGGCCGCGGGGAGCGGGG - Intronic
1122993171 14:105248544-105248566 CACCGGCGCCGCGGCGGGTACGG + Intronic
1124129365 15:26971123-26971145 CAGCGCCTCCGAGGCGGTCCCGG - Intergenic
1124227008 15:27903292-27903314 AAGCACCGCCGTGGCGGGCTTGG - Intronic
1124652353 15:31483406-31483428 CAGCGCCGCTGCACCGGCCCCGG + Exonic
1125508785 15:40282025-40282047 CGCCGCCGCCGCTGCGGCCCGGG - Exonic
1125999399 15:44195071-44195093 CAGCGCCGCCGCGTCGCTCCCGG - Exonic
1127117583 15:55743191-55743213 CAGCGCCGCGGCCGCGGGCCTGG + Intergenic
1128454692 15:67825874-67825896 CAGCGCCGCCGCCGAGGCTCGGG - Intronic
1129919998 15:79311635-79311657 CAGCGCCGCAGGTGCGAGCCCGG + Intronic
1130305352 15:82709480-82709502 CGGCGCGGCCGGGGCGGGGCCGG + Intronic
1130564466 15:84981852-84981874 AAGCGCGGCCGAGGCGAGCCCGG + Intronic
1132143937 15:99415681-99415703 CAGTGCAGGCGCGGCAGGCCCGG - Intergenic
1132255571 15:100373478-100373500 CGCCGCCGCCGCGCCTGGCCGGG - Intergenic
1132466123 16:78131-78153 CTGCGCCCCCGGGGCGGGGCGGG - Intronic
1132594320 16:741238-741260 CAGCGCCGCAGCTCCGGCCCCGG + Intronic
1132683458 16:1153034-1153056 CAGCGTGGCCGGGGCGGGGCCGG - Intergenic
1132698230 16:1211364-1211386 CAGCAGCGCCGCTGCGGGACGGG + Intronic
1132779293 16:1614160-1614182 CTGCGCCGCCTCGGCCGGCCGGG - Intronic
1132970010 16:2682617-2682639 CAGCGCTGCAGCGGCGGCACAGG - Exonic
1133156770 16:3881099-3881121 CAGCGCCGCCCCAGCGGGACGGG - Intergenic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1133784481 16:8963715-8963737 CAGGCCCGCCGCGGCCGGCCAGG - Intronic
1134588743 16:15434863-15434885 AAGCGCCCCCGCAGCGGGGCTGG + Intronic
1135821887 16:25692388-25692410 CGCCGCCGCCGCCGCGAGCCGGG + Exonic
1136381977 16:29900109-29900131 TCGCCCCGCCGGGGCGGGCCCGG + Intergenic
1136483855 16:30558555-30558577 CTGCACCGCCTCGCCGGGCCGGG - Intergenic
1136483865 16:30558591-30558613 CTGCACCGCCTCGCCGGGCCGGG - Intergenic
1136498815 16:30659615-30659637 CAGCGGCGCCGCCGAGGTCCAGG + Exonic
1137268015 16:46884532-46884554 CAGCGGCGCCGTGGAGGGTCCGG + Intronic
1137454844 16:48610185-48610207 CTTTGCCGCCGCCGCGGGCCGGG + Exonic
1137614565 16:49838915-49838937 CGGGGCCGCCCCCGCGGGCCGGG + Intronic
1138360751 16:56425442-56425464 CGCCGCCGCCGCGCCGGGCCGGG + Exonic
1138514567 16:57528989-57529011 CAGCGCGGGCGCGGGGGGCAGGG + Exonic
1139364833 16:66427048-66427070 CGCCGCCGCCGAGGGGGGCCGGG + Intergenic
1139475078 16:67199065-67199087 CGGGGCCGCCTCGGCGGGGCGGG + Intergenic
1139908262 16:70381131-70381153 CAGCGCGGCCGAGGTGGGACTGG + Exonic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1141054616 16:80804017-80804039 CGCCGCCGCCGCCGCGGGCTCGG + Intronic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141683377 16:85556637-85556659 CTCCGCCGCCGCGGCGGAGCCGG - Intergenic
1141693976 16:85611491-85611513 CAGCACCCCCGCGCCGTGCCAGG + Intronic
1141727562 16:85799775-85799797 CGGCGCCGCCAGGCCGGGCCGGG + Exonic
1142211908 16:88812384-88812406 CAGGGCGGAGGCGGCGGGCCTGG + Intergenic
1142412474 16:89923579-89923601 CAGCGCCGCGCCGGGCGGCCGGG + Intronic
1142811796 17:2399017-2399039 TGCCGCCGCCGCGGCGGGCGGGG - Intronic
1143676414 17:8436145-8436167 AGGCTCCGCCGGGGCGGGCCGGG + Intronic
1144339745 17:14301679-14301701 CAGCCCCGGCGCGGCGGCGCAGG - Exonic
1144787494 17:17840180-17840202 CAGCCCCGCCCCCGCGGGCCCGG + Intergenic
1144870047 17:18363627-18363649 CTGCGGCGCAGCGGCGGGCAGGG + Intergenic
1145904337 17:28508015-28508037 CAGCGCGGGCGGGGCGGGGCTGG - Intronic
1146142433 17:30379330-30379352 CGGCCCCGCAGCGTCGGGCCCGG - Exonic
1146398590 17:32487092-32487114 CGGCCCCGCCGCCGCGGTCCCGG - Exonic
1147395264 17:40137947-40137969 CTGAGCCACCGCGCCGGGCCTGG - Intergenic
1148095700 17:45051554-45051576 CAGCGCCTCCGCCGTGGCCCAGG + Intronic
1148664078 17:49361854-49361876 CACCGCCGCGGCGGCGCCCCCGG - Intronic
1148796581 17:50200117-50200139 CAGCGCCGAGGCGCCTGGCCAGG + Intronic
1149614799 17:57988415-57988437 CAGGGCCCCCGCGGGGGGGCTGG + Intergenic
1150239801 17:63622502-63622524 CGGCGCCGCCGAGGCCGGGCTGG + Exonic
1150311053 17:64129893-64129915 CAGCGTCGCGGCGCCGGGGCTGG - Intronic
1150488790 17:65560928-65560950 CCCCGACGCCGCGGCCGGCCCGG - Intronic
1151612168 17:75183150-75183172 GCGCGCCCCCGCGGCGGGCCGGG - Intergenic
1151662383 17:75525686-75525708 CACCTCCGGCGCGGCGAGCCTGG - Intronic
1151758778 17:76089150-76089172 CAGAGCCCCCGGGGCGGGGCGGG + Intronic
1152082907 17:78199653-78199675 GTGCGCCGCCGCGCCCGGCCAGG + Intronic
1152111318 17:78359235-78359257 CAGGGGAGCCGGGGCGGGCCGGG - Intronic
1152350981 17:79784055-79784077 CAGCGCCCCCGTTGCAGGCCTGG + Exonic
1152396289 17:80035709-80035731 CAGCGCCCCCTCGGCGGAGCTGG - Intronic
1152628649 17:81399793-81399815 CAGCGGCGCTGCGGTGGCCCAGG - Exonic
1153794489 18:8609741-8609763 CCGCGCTGCAGAGGCGGGCCGGG + Exonic
1154303998 18:13217801-13217823 GCGCGCCGCCGCGGCCGGCCGGG + Intronic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1157353987 18:46917111-46917133 CGGCGCGGGGGCGGCGGGCCTGG - Intronic
1157384320 18:47248374-47248396 CACCGCGGCCGCGGCGGCCACGG + Intronic
1158436027 18:57435920-57435942 CAGCGGCGCCGCGGCCCGCGTGG - Exonic
1159040540 18:63319919-63319941 CAGCGCCGCCGCGCAGGACCAGG - Exonic
1159057071 18:63476865-63476887 GAGTGCCGCCGAGGCGGGGCGGG + Exonic
1160543651 18:79638754-79638776 CAGCGCCGCCGCGTCTGGACAGG - Intergenic
1160631172 18:80247247-80247269 CAGGGCCGCCGGGGCGGGCGGGG + Intronic
1160701132 19:507924-507946 CAGCGCCGGCGCAGGGGCCCGGG + Intronic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160792672 19:929750-929772 CAGAGCCGCCGGGGCTGGCTGGG - Exonic
1160910346 19:1471077-1471099 CGGCGCAGCCGCGGCGGGCGAGG + Exonic
1160921798 19:1524145-1524167 CTGCGCCGCCGCCGCGGCCGGGG - Intronic
1160935482 19:1592656-1592678 CCGGGCGGCGGCGGCGGGCCCGG - Exonic
1160966622 19:1749572-1749594 CTGGGCGGCCGCGGCTGGCCGGG - Intergenic
1161029592 19:2051472-2051494 CAGCGACCCTGCGGCGCGCCCGG + Intergenic
1161076860 19:2290033-2290055 GCCGGCCGCCGCGGCGGGCCAGG - Exonic
1161317375 19:3623928-3623950 CAGGGCAGCCGCGGCCGCCCGGG + Exonic
1161327843 19:3672002-3672024 CAGAGCCCCCGCCTCGGGCCTGG - Intronic
1161513201 19:4683061-4683083 CCCCGCCGCCGCAGAGGGCCGGG + Intronic
1161664669 19:5568062-5568084 CCGCCCCGCCCCGCCGGGCCGGG - Intergenic
1161959555 19:7516208-7516230 CGGCGCGGGCGCGGCGGGCCGGG + Exonic
1162021360 19:7869924-7869946 GAGGGCGGCGGCGGCGGGCCGGG + Exonic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162457898 19:10796836-10796858 CCGCGCCAACGCCGCGGGCCTGG + Intronic
1163027044 19:14518477-14518499 CGGCGCCGCGGGGGCGGGCGGGG - Intronic
1163282340 19:16325392-16325414 CAGCGCCCCCGCGGGTGGCCTGG + Exonic
1163729499 19:18941023-18941045 CAGCGCAGGCTCGGCAGGCCGGG + Intronic
1165058640 19:33194460-33194482 GAGCCCCGCCGCGGCCGGCCTGG - Intronic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1165454022 19:35900474-35900496 CAGCGCCGAGGCCGCGGCCCTGG - Exonic
1165772852 19:38388716-38388738 CAGCGCCGCCGGAGCCAGCCAGG + Intronic
1165851391 19:38852053-38852075 CCCCGCCCCCGCGGCCGGCCCGG + Intronic
1165924850 19:39320682-39320704 CCGTGGCGCTGCGGCGGGCCCGG - Intergenic
1165961623 19:39539803-39539825 CAGGGCAGCCGCGGCGGGCAGGG - Exonic
1166215327 19:41331015-41331037 CCGCCCCGCCCCGGCAGGCCCGG - Exonic
1166303814 19:41926692-41926714 CTGGGCCGCGGCGGCCGGCCGGG + Intronic
1166688345 19:44809068-44809090 CAGCTCGGCCGCTGCGGGGCTGG - Intronic
1167220311 19:48194945-48194967 CTGCGCCGCCACCTCGGGCCCGG - Exonic
925169952 2:1744267-1744289 CTGCGGCGCCACGGCGGGCACGG + Exonic
926077129 2:9951038-9951060 GCGCGCGGCCGCGGTGGGCCAGG + Intergenic
927168800 2:20351071-20351093 GGGCTCCGCCGCGGCGGGCTCGG + Intronic
927714115 2:25341630-25341652 CCGCGCCGCCCCGGCCAGCCCGG + Intronic
929604244 2:43224819-43224841 CTGCGCCTCCGCGGCGGCCGCGG - Exonic
930527004 2:52542790-52542812 CAGCTCAGCCGCGGCAGGACAGG + Intergenic
931256927 2:60581938-60581960 CTGTGCCGCCGCCGTGGGCCGGG + Intergenic
931321373 2:61177377-61177399 CCGCCCTGCCGCGGCGCGCCCGG - Intergenic
932385907 2:71332235-71332257 CAGCGCAGCCTCGGCAGGCCGGG - Intronic
934296836 2:91749090-91749112 CAGCGCCGCGGCGGCGCCCCGGG + Intergenic
935746510 2:106194084-106194106 CCCCGGCGCCGCGGTGGGCCGGG - Intronic
935904388 2:107827415-107827437 CATCGCGGCCGCGGCCGGGCCGG - Intronic
936038326 2:109129651-109129673 CACCGCCGCGGGGGCGGGCGAGG + Exonic
937284542 2:120741755-120741777 GAGGGCCGCAGCCGCGGGCCCGG - Intronic
937375889 2:121335410-121335432 CAGCGCCGCCGCTACAGGGCTGG - Intergenic
938073112 2:128318678-128318700 CCGCGCCGCTGCGGGCGGCCTGG - Intergenic
938876018 2:135531865-135531887 CGGAGCCGCAGCCGCGGGCCAGG - Intronic
941905580 2:170714679-170714701 CGGCCCCACCGCGGCGGGCGGGG + Intergenic
943571511 2:189580777-189580799 CGCCGCCGCCGCCGTGGGCCGGG + Exonic
946327671 2:218993149-218993171 CAGCGCCCCCGCGCCGGGCCCGG - Exonic
946921424 2:224585152-224585174 CGCCGCCGCCGCGGCTGCCCAGG - Exonic
947523454 2:230865197-230865219 CAGGGCCGACGGGGCGCGCCTGG - Intronic
947717920 2:232351172-232351194 CAGCGCCACCGGGGCTGGGCCGG - Intergenic
947800645 2:232927326-232927348 CAGCGCCGCCCCTCCCGGCCGGG + Intronic
948248696 2:236507641-236507663 CTGCGCCACCGCGGGAGGCCTGG + Intergenic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
948643019 2:239387349-239387371 CAGTCCCGCCGCTGCGTGCCTGG + Intronic
949000444 2:241610149-241610171 CAGGGCCGCGGCGCCGGGCATGG + Intronic
949044578 2:241866633-241866655 CAGCGCTGCCCAGGCGGGCAGGG - Intergenic
1169065483 20:2692619-2692641 CCGCCCCGCCGCCGCGGCCCGGG + Intergenic
1169145403 20:3248941-3248963 CAGCTCGGCCGCGGCAGGCTGGG + Intergenic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1170150470 20:13221620-13221642 CAGCGCCAGCCCCGCGGGCCCGG + Intergenic
1171473561 20:25390614-25390636 CAGCGCCGCGGCGGCCGAGCCGG + Exonic
1172775896 20:37406698-37406720 CCGCGCTGCCGCGGCGGGTCAGG + Intergenic
1172962189 20:38806831-38806853 CTGCGCCGCTGCCGCGCGCCAGG + Intronic
1173813584 20:45971272-45971294 CAGCGACGCCGCGGCCGCCCCGG - Exonic
1175399455 20:58692529-58692551 CAGCGCCTCCCGGACGGGCCTGG - Intronic
1175429502 20:58891621-58891643 CAGCGCCGGGCGGGCGGGCCGGG - Intronic
1175847007 20:62064803-62064825 CGCAGCCGCCGCGCCGGGCCCGG + Exonic
1175859706 20:62143634-62143656 GAGCGGCGGCGCCGCGGGCCCGG + Intergenic
1175927036 20:62476039-62476061 CGGCGCGGCGGGGGCGGGCCGGG - Intergenic
1175943970 20:62550299-62550321 CAGCTGGGCCGCGGCTGGCCCGG - Intergenic
1176234581 20:64048484-64048506 GAGCGGCGCCGCGGGGGGCGCGG + Exonic
1176237969 20:64063094-64063116 GAGCGCGGGCGCGGCGGGCGCGG + Intronic
1176381063 21:6112104-6112126 CAGCGCGGACCCCGCGGGCCAGG + Exonic
1176548445 21:8211824-8211846 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1176556337 21:8256030-8256052 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1176567376 21:8394859-8394881 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1176575276 21:8439072-8439094 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1178314904 21:31559393-31559415 CAGCGGAGGCGCGGCGGGCCGGG + Intronic
1178493806 21:33070782-33070804 CAGGCGCGGCGCGGCGGGCCCGG - Exonic
1178680661 21:34670042-34670064 CAGCGTAGACGCGGAGGGCCGGG + Exonic
1178680679 21:34670102-34670124 CAGCGTAGACGCGGAGGGCCGGG + Exonic
1178948414 21:36966719-36966741 CCGCGCCGCCCCCCCGGGCCAGG + Intronic
1179495231 21:41767056-41767078 CAGCGCCGCGGCGGCTGCCCAGG + Exonic
1179742409 21:43426136-43426158 CAGCGCGGACCCCGCGGGCCAGG - Exonic
1180614811 22:17120359-17120381 CTGCGCCGCCCCGACGGCCCCGG + Exonic
1182350246 22:29695365-29695387 GAGCGCCGCCTCGGGGTGCCTGG - Exonic
1182576518 22:31276698-31276720 CAGCGGCACCGCGGGGGGCGCGG + Intronic
1183524999 22:38317491-38317513 CGGGGCGGCGGCGGCGGGCCGGG - Intronic
1183545915 22:38454889-38454911 CGGGGCCGGAGCGGCGGGCCCGG + Intronic
1183683774 22:39350215-39350237 CGGCGGCGCGGCGGCGGGCGAGG + Intronic
1183702166 22:39457106-39457128 CTCCGCCGCCGCGCCGGGCCGGG - Intergenic
1184280802 22:43436398-43436420 CAGGGCAGCCGCGGTGAGCCAGG + Intronic
1184337545 22:43862570-43862592 CAGCGCCGCGGCCGCGTGCCGGG - Intergenic
1184680698 22:46071076-46071098 CAGGGCGGCGGGGGCGGGCCGGG + Intronic
1184684484 22:46089973-46089995 CAGAGCGGCCGCCGCGGTCCTGG + Intronic
1184697881 22:46150152-46150174 CAGCCCCGCCCCGGTGCGCCGGG + Intergenic
1184712790 22:46262993-46263015 GAGCGCGGGCGCGGCCGGCCAGG + Exonic
1184759406 22:46536469-46536491 CGGGGCCGGCGCGACGGGCCCGG - Exonic
1185055261 22:48575859-48575881 CACCGCCGCCGCGGCGGGCCAGG - Intronic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
1203253327 22_KI270733v1_random:128127-128149 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1203261382 22_KI270733v1_random:173206-173228 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
949993780 3:9600847-9600869 CGGTGGCGCCACGGCGGGCCCGG + Intergenic
950082662 3:10234665-10234687 CAGCGAGGCCGCTGCGGGCGAGG - Intronic
950153823 3:10707980-10708002 CAGCGGGGCCGGGCCGGGCCGGG - Intronic
950282678 3:11720448-11720470 CAGAACGGCCGCGGCGGTCCCGG + Intronic
951208285 3:19947110-19947132 CAGCGACGTGGCGGCGGGGCCGG + Exonic
952430470 3:33218726-33218748 CAGCGCCGCCGCCCAGAGCCCGG + Exonic
953356881 3:42263680-42263702 CAGAGCTCCTGCGGCGGGCCGGG + Intronic
953705316 3:45226158-45226180 CCGCGCCGCCCCTGCGGGCTTGG - Exonic
954004232 3:47578916-47578938 CGGGGCCGGCGCGGCGGGCGGGG - Exonic
954121980 3:48504770-48504792 CAGCGCTGGCGCAGTGGGCCAGG + Intronic
954384250 3:50236154-50236176 CACCGACGGCGGGGCGGGCCGGG - Exonic
954743184 3:52770889-52770911 CAGCGGCGTCGTCGCGGGCCGGG - Exonic
954912699 3:54122400-54122422 CGGCCCCGCCTCGGCGGCCCCGG - Intergenic
954912700 3:54122401-54122423 CGGGGCCGCCGAGGCGGGGCCGG + Intergenic
958900140 3:99876283-99876305 CTGCGCCGCCGCCGCGGCCGAGG - Intronic
959591892 3:108090911-108090933 CGGCGACCCCGCGGCGGGCGCGG - Exonic
961733839 3:128987911-128987933 CAGCGCTGCTGCTGAGGGCCAGG - Intronic
963061745 3:141231866-141231888 CAGCTCCGTCGCTGCGCGCCCGG - Exonic
965590365 3:170356816-170356838 CCGCCCCGCCCCGGCGGCCCCGG - Intergenic
966182260 3:177197743-177197765 CAGTGCCGCCAGAGCGGGCCGGG - Intergenic
966740137 3:183224981-183225003 CAGCACAGCCGCTGTGGGCCAGG - Intronic
966915827 3:184583715-184583737 CCGCGCCGCCGCAGCCGGCCCGG + Intronic
967859636 3:194141371-194141393 CAGGGCCGCCAGGGCTGGCCCGG - Intergenic
967859741 3:194141715-194141737 CCGCGCGGCCCCGCCGGGCCTGG + Intergenic
968514393 4:1010202-1010224 CAGGGCCGCGGCGGCGGCGCAGG + Intronic
968660021 4:1794997-1795019 GACCGCGGGCGCGGCGGGCCGGG + Intronic
968674551 4:1870814-1870836 AGGCCCCGCCGTGGCGGGCCCGG - Intergenic
969416990 4:7067531-7067553 CAGCGAGGCCGAGCCGGGCCGGG - Intronic
969716684 4:8871369-8871391 CCGCGCCTCCCCGCCGGGCCCGG + Exonic
979547275 4:121951977-121951999 CATCGCCGCCGCCGCGGGGCTGG - Intergenic
980130380 4:128811663-128811685 CGGGGCGGGCGCGGCGGGCCGGG - Intronic
980669660 4:135987867-135987889 CTGAGCCACCGCGCCGGGCCAGG + Intergenic
980923901 4:139115344-139115366 CAGCGGCACCGCGGGGGGCGCGG - Intronic
981270744 4:142845723-142845745 CGCCGCCGCCGCCGCCGGCCTGG - Intronic
983649843 4:170026682-170026704 CCGCGCTGCCGCGGAGGCCCTGG - Intronic
983940261 4:173529478-173529500 CAGCGCTGCTGAGGCGGGCCCGG - Exonic
984772111 4:183444932-183444954 CAGCGCCGCCAGCGGGGGCCAGG - Exonic
984966364 4:185143509-185143531 GGGCGCGGGCGCGGCGGGCCGGG + Intronic
985073536 4:186191412-186191434 CAGCCCCGCTGGGGCGCGCCGGG + Intergenic
985565276 5:612318-612340 CGGCGCCTGCGCGGCGGGCGGGG - Exonic
985783326 5:1881973-1881995 CTGGGCCGAGGCGGCGGGCCCGG + Exonic
985963787 5:3324582-3324604 CAGCCCCACCGCGCCGGGTCAGG - Intergenic
986402840 5:7396196-7396218 CCGCGCCGCCTCGGCCGGCCCGG - Exonic
986506632 5:8458130-8458152 CAGGGACGACGCGGCGGGCAGGG - Intergenic
986695930 5:10354108-10354130 CCGCGCCGCCGAGGGGGGCGGGG + Intronic
987132476 5:14872041-14872063 CAGCGCCGCCGCCCCCGGGCCGG - Intergenic
988595297 5:32585516-32585538 CAGCCCCAGCGCGGCGGGGCCGG + Exonic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
989584785 5:43066376-43066398 CAGCGGCGCCGCCGGGGGACTGG + Intronic
989963298 5:50440945-50440967 CATCGCCGGCGCGCCGGGCAAGG - Intronic
990347446 5:54884123-54884145 CGGGGCCGCCGCGGCGGGATGGG - Intergenic
992067403 5:73120508-73120530 CTGCGCGGGCGCGGCGGCCCGGG - Exonic
992866275 5:80960383-80960405 CCGAGCCCCCGCGGCGGGCTGGG - Intergenic
993116145 5:83722201-83722223 CCGCGCCGCCCCGCCGGGGCCGG - Intergenic
994197560 5:96936389-96936411 CAGCGCCGCCGCCGCTCGCCCGG + Intronic
995809126 5:116085179-116085201 CCTGGGCGCCGCGGCGGGCCCGG + Intronic
996298570 5:121954208-121954230 CAGCGGCGCCGGCGCGGGCGCGG + Intergenic
999315658 5:150582401-150582423 CACCGCGGCAGCGGCGGGCCTGG + Intergenic
1003545019 6:7051868-7051890 CCGCGCCACCGGGCCGGGCCGGG - Intergenic
1004140533 6:13013752-13013774 AAGCACCGCCGCGGCGGGGCGGG - Intronic
1005453065 6:25992606-25992628 CAGGGCCGGCGCTGCGGGCGGGG - Intergenic
1005473924 6:26188944-26188966 TGACGCCGCCGCGGCGAGCCAGG + Exonic
1006396161 6:33788868-33788890 CGGAGAGGCCGCGGCGGGCCGGG + Exonic
1007558108 6:42783149-42783171 GCGCGCCGCCGCCGCGGGCTCGG - Intronic
1007739138 6:44000509-44000531 CACTCCCGCCGCGGCAGGCCAGG + Intergenic
1007927743 6:45663556-45663578 GCTCGCCGCAGCGGCGGGCCGGG - Intronic
1008920883 6:56843511-56843533 CAGCGCGGCCGCAGAGGGTCCGG - Intronic
1008932469 6:56954936-56954958 CGCCGCCGCCGCGGCCGCCCGGG + Intergenic
1012100996 6:95085023-95085045 CAGAGCCGGTGCGGCGTGCCTGG + Intergenic
1012475806 6:99613858-99613880 CAGCGCGGCGGCTGCGGGCGGGG - Exonic
1013978217 6:116100829-116100851 CCGCCCCGCCGCGTCCGGCCCGG + Exonic
1014205288 6:118650781-118650803 CAGTGCTGCGGCGGCGGCCCGGG - Intronic
1015149342 6:130020219-130020241 TCGCGCCGCGGCGGCGGGGCGGG + Intronic
1015999639 6:139029464-139029486 CAGACCCGCGGCGCCGGGCCGGG + Intronic
1016010655 6:139135150-139135172 CCGCGCGGGCGCCGCGGGCCCGG - Exonic
1016982188 6:149863886-149863908 CAGCGGCGCCGCGGGCGGCAAGG + Exonic
1017842334 6:158232163-158232185 CACCGCCGCCGCCGCCGGCCCGG - Intergenic
1018613006 6:165662029-165662051 CAGCGCGGCCGCGGCGGCGAGGG + Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019989551 7:4682247-4682269 CAGCGGCGGCGCGGGGGGCGGGG - Intergenic
1020037666 7:4974444-4974466 CACCGCCTCCGCGGCGGCCTCGG - Intergenic
1020106392 7:5424066-5424088 CAGCCCCGCCGAGGGGAGCCTGG - Intronic
1020107635 7:5429465-5429487 CAGCCCTGCCGCGGCGCCCCAGG + Intergenic
1020162152 7:5781180-5781202 CACCGCCTCCGCGGCGGCCTCGG + Intronic
1020225010 7:6272752-6272774 CAGCGCAGACGCCGCCGGCCCGG - Intergenic
1021231053 7:18086735-18086757 CAGCGCCGCGGAGGCTGGGCGGG - Intergenic
1021600223 7:22356986-22357008 CACCGCCGCCGCGGCGGCCAGGG + Intronic
1022285963 7:28956534-28956556 CGTCGCTGCCGCCGCGGGCCCGG - Exonic
1022427951 7:30285543-30285565 CGGCGGCGCCGCGGCGGCCGCGG + Exonic
1023637587 7:42228070-42228092 CCGCGCCGCCGCCGCGGCCTGGG - Intronic
1023972289 7:45000235-45000257 GAGCGCGGGGGCGGCGGGCCCGG + Intronic
1025069676 7:55887590-55887612 CGCCGCCGCCGCGGTGGACCCGG - Intronic
1025089669 7:56051786-56051808 CAGAGCCGGCGCGGCGTGGCCGG - Exonic
1026987008 7:74561051-74561073 CAGAGCCTCCAGGGCGGGCCAGG + Intronic
1026994505 7:74606663-74606685 CAGCCCCGCCGCTCCCGGCCGGG - Intergenic
1028417623 7:90596505-90596527 CACCACCTCCTCGGCGGGCCGGG - Intronic
1028621437 7:92833346-92833368 CGGCGCCGCTGGGGCGGGCGGGG + Exonic
1029075075 7:97928487-97928509 CACCTCCGCCACGCCGGGCCCGG + Intergenic
1029607234 7:101606354-101606376 CGGCGGCGCCGGGGCAGGCCCGG + Intergenic
1029813984 7:103075237-103075259 CAGAGCCGCAGCGCCGGGCCAGG - Exonic
1031051882 7:116953440-116953462 CGCCGCCGCCGCCGCGGCCCGGG - Exonic
1031895979 7:127348000-127348022 CAGCGCCGCCGCCCTGCGCCCGG - Intronic
1031966800 7:128032590-128032612 CAGCCCCGCCGCGGGCCGCCGGG - Intronic
1033477200 7:141702229-141702251 CAACGCCGCCGCCGCCCGCCGGG + Intergenic
1034347649 7:150397202-150397224 GGGCGCCCCCGCGGCGGCCCCGG - Exonic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1034659853 7:152759754-152759776 CAGCGCCGCTGCCGGGAGCCCGG - Exonic
1035023527 7:155812293-155812315 CCCCGCAGCCGCGGCGGGCAAGG - Intergenic
1035169534 7:157009939-157009961 CGCCGCCGCCGCTGGGGGCCTGG - Exonic
1036195271 8:6708499-6708521 CCGCGCCGCCGCCCGGGGCCGGG - Exonic
1036242450 8:7091892-7091914 CAGCGCGGACACGCCGGGCCCGG - Intergenic
1036432170 8:8701865-8701887 TCGCGCCGCCCCGCCGGGCCAGG - Intergenic
1036432327 8:8702376-8702398 CGCCGTCGGCGCGGCGGGCCGGG + Exonic
1036899366 8:12659538-12659560 CAGCGCGGACACGCCGGGCCCGG + Intergenic
1036900433 8:12665685-12665707 CACCGCCGCCACGCCGGGCTCGG + Intergenic
1037928979 8:22865973-22865995 CAGCGCTGGCGCGGCCGGCTGGG - Intronic
1037947728 8:22999709-22999731 CAGCGCCTTCGCCGCGGGCCCGG + Intronic
1041910704 8:63085914-63085936 CGGCGCTGCGGCGCCGGGCCCGG - Exonic
1042040207 8:64581369-64581391 CAGCGTCCCCCCGGGGGGCCTGG + Exonic
1042611696 8:70607882-70607904 CAGCTCCCCGGCGGCCGGCCCGG - Intronic
1044430730 8:92103412-92103434 CAGGGGCGCCGCGGCCGGTCGGG + Intergenic
1044569386 8:93700514-93700536 TCGCGCCGCCGCGGCAGGCCGGG - Exonic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1045112015 8:98945180-98945202 CTGCGCTGCCGCGGCTGCCCCGG - Intronic
1045304989 8:100951240-100951262 GGGCGCCGCCGCGCCAGGCCTGG + Intronic
1045443618 8:102239008-102239030 CAGGACCGGCGCGGCGGGGCGGG - Exonic
1045564365 8:103298796-103298818 CGCCGCCGCCGCCGCGAGCCCGG + Intronic
1045738011 8:105318838-105318860 CGCCGCCGCCGCCGCTGGCCAGG - Exonic
1049234972 8:141507904-141507926 CAGAGCGGCCGCTGTGGGCCTGG + Intergenic
1049245023 8:141557795-141557817 CAGCCCCTCCCCGGCAGGCCTGG - Intergenic
1049373939 8:142280260-142280282 CAGGGCTGCCGCGGCCGGCTCGG + Intronic
1049512740 8:143037955-143037977 CATCGCTGCCGGGGCTGGCCAGG - Intergenic
1049585065 8:143429226-143429248 CAGCACGGCCGGGCCGGGCCTGG + Exonic
1049649856 8:143760875-143760897 CATCGCCGCGCAGGCGGGCCCGG + Intergenic
1049693716 8:143973623-143973645 CTGCCCGGCCGCGGCGGCCCCGG - Intronic
1049762502 8:144337573-144337595 CAGCGGCGTCGCTGCGAGCCGGG + Intergenic
1049936274 9:504454-504476 GAGCGCCCCCGCGGGGAGCCGGG + Intronic
1051079689 9:13279656-13279678 CACCGCCTCCGCGGCAGCCCCGG - Intergenic
1053198363 9:36136739-36136761 CAGCGCAGCCGCGGGGAGCGAGG + Exonic
1053240094 9:36487899-36487921 CCGCGCCTCAGGGGCGGGCCTGG - Intergenic
1055090984 9:72364790-72364812 TGGTGCCGCCGCCGCGGGCCGGG + Intronic
1057921990 9:99105160-99105182 CGGCGCGGCCGGGCCGGGCCGGG + Exonic
1058110798 9:101029177-101029199 CTGCGCCGCCGGGTCCGGCCAGG - Intronic
1059234528 9:112750773-112750795 CAGCGGACCCGCGGCGGGCTCGG + Intergenic
1059375232 9:113876171-113876193 CGGCGCGGCCGGTGCGGGCCGGG + Intergenic
1060209035 9:121699262-121699284 TAGCGCGGCGGCGGCGGGCCGGG - Intronic
1060283479 9:122228855-122228877 CGGCCCCGCCGCCCCGGGCCCGG + Intronic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1060770150 9:126326737-126326759 GCGGGCCGCGGCGGCGGGCCGGG - Intergenic
1061128244 9:128689842-128689864 CAGCGCGGCCGCCGCGGCGCGGG - Intronic
1061128314 9:128690079-128690101 CGGGGGCGCCGCCGCGGGCCGGG - Intronic
1061257402 9:129460632-129460654 CTGCTCGGCCGCCGCGGGCCCGG + Intergenic
1061415662 9:130445570-130445592 CAGCCCCACCGGGGAGGGCCAGG - Intronic
1061419643 9:130466330-130466352 CAGAGCTGCCGCTGCTGGCCTGG - Intronic
1061987091 9:134136175-134136197 CCGGGCCGCGGCGGCGGGGCCGG - Exonic
1062284125 9:135765562-135765584 CAGGGCCGCCCGGGCGGGGCAGG + Intronic
1062646332 9:137550504-137550526 CATCCCCGCCGCGCTGGGCCTGG - Exonic
1203469727 Un_GL000220v1:111274-111296 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1203477548 Un_GL000220v1:155246-155268 CGGCGGCGTCGCGGCGGGTCTGG + Intergenic
1185894079 X:3843216-3843238 CCGAGCCGCAGCGGCGGGGCAGG + Intronic
1185899197 X:3881640-3881662 CCGAGCCGCAGCGGCGGGGCAGG + Intergenic
1185904314 X:3920069-3920091 CCGAGCCGCAGCGGCGGGGCAGG + Intergenic
1186496505 X:10015720-10015742 CCGCGCCGCCGCCGCGGGCCCGG + Exonic
1188511184 X:30938052-30938074 GAGAGCCACCGCGCCGGGCCTGG + Intronic
1189324042 X:40102456-40102478 CGACGCCGCCGCGCTGGGCCGGG + Intronic
1190618436 X:52262201-52262223 CAGCGCCCCCGGGGCTGACCAGG + Intergenic
1190952626 X:55161526-55161548 CAGCGCCCCCGGGGCTGACCAGG + Intronic
1192034320 X:67546339-67546361 CTGCGCCGCCGCAGCCGCCCAGG - Exonic
1196819570 X:119692460-119692482 CGGCGCCGCCGCCGCCCGCCCGG + Intronic
1196965118 X:121047437-121047459 CGGCGAGGCCGCGGCGGGTCCGG + Intergenic
1200098203 X:153673902-153673924 CAGCGCGGCCGCGGCGCCGCAGG + Intronic