ID: 913206406

View in Genome Browser
Species Human (GRCh38)
Location 1:116543225-116543247
Sequence GGCTGAGTAGGGAGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 806
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 738}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913206406 Original CRISPR GGCTGAGTAGGGAGGGCAGC AGG Intronic
900204726 1:1427083-1427105 GGCTGAGCAGGGCGGGAAGAGGG - Intronic
900269786 1:1781149-1781171 GGCTGAGGAGAGAGGGAAGTTGG + Intergenic
900274411 1:1814699-1814721 GGCTGAGTAGGAAGGGTTACTGG + Intronic
900387314 1:2416546-2416568 AGCTGGGGAGGGTGGGCAGCGGG + Intergenic
900402464 1:2478170-2478192 GGCCGAGCAGGGTGGGGAGCAGG + Intronic
900504312 1:3021663-3021685 GGCTGAGAAGGGAAGGCTGCGGG + Exonic
900508759 1:3045849-3045871 GGCTGAGCAGGGAGGATTGCTGG + Intergenic
900571709 1:3361865-3361887 GGCCCAGGAGGGAGGGCAGGTGG + Intronic
900857886 1:5200584-5200606 GGATGAGTGAGGAGGGCAGCAGG - Intergenic
901413780 1:9103538-9103560 GGATGAGTAGGGAGGGGTTCTGG - Exonic
901538900 1:9901956-9901978 GGCTGGGTAGAGAGGGCAAAGGG - Intronic
901783883 1:11611977-11611999 GTGTAAGTAGGGAGGGCTGCAGG + Intergenic
901877385 1:12174721-12174743 GAGGGGGTAGGGAGGGCAGCTGG - Intronic
901910917 1:12457281-12457303 GGCAGAGGAGGGAGAGCAGAAGG - Intronic
902232410 1:15036337-15036359 GGCCGAGCAGGCAGGGCAGGGGG - Intronic
902439737 1:16421610-16421632 GGCTGAGAGGGGAGGGCAGGGGG - Intronic
902591171 1:17475800-17475822 GGCTGAGGTGGGAGGGCTACTGG + Intergenic
902662233 1:17913263-17913285 GGGTGAGAAAGGAGGGCAGTAGG - Intergenic
902781213 1:18706122-18706144 GAGTGAGGAGGGAGGGCAGTGGG - Intronic
902829003 1:18997609-18997631 GGCTGGGTTGGGCTGGCAGCAGG - Intergenic
903232745 1:21931745-21931767 GGCTCAGGAGGGAGGGCAGGAGG - Intronic
903295798 1:22342410-22342432 GGCTGAGCAGGCAGGCAAGCAGG + Intergenic
903320879 1:22542554-22542576 GCCGGGGTAGGGAGGGCAGTGGG + Intergenic
903420968 1:23217561-23217583 GGCCGAGTAGGGAGGGAGCCCGG - Intergenic
903611048 1:24613043-24613065 GGCTGGGGAGAGAGGGCAGTGGG - Intergenic
903864062 1:26385212-26385234 GGCTGAGGTGGGAGGGTGGCTGG + Intergenic
903865198 1:26392738-26392760 GGAGGAGTAGAGAGGGCAGGAGG + Intergenic
904140661 1:28350491-28350513 GGCTGAGGAGGGAGGATCGCTGG - Intergenic
905053280 1:35071567-35071589 GGCTGAGGTGGGAGGACTGCTGG - Intronic
905079559 1:35305642-35305664 GGCTGAGATGGGAGGACTGCTGG - Intronic
905170955 1:36109226-36109248 GGGTGAGCAAGCAGGGCAGCCGG - Intronic
905239218 1:36571538-36571560 GGCTGAGGAGAGGGGACAGCTGG - Intergenic
905352389 1:37356637-37356659 GGCAGAGTATGGTGGGCAACGGG + Intergenic
905727372 1:40264776-40264798 GGCTGAGGTGGGAGGGTTGCTGG + Intronic
906193989 1:43918217-43918239 GGCTGAGGTGGGAGGACTGCCGG - Intronic
907281276 1:53348897-53348919 GGCTCAGCAGGGACGGCACCAGG + Intergenic
907864773 1:58389200-58389222 GGCCGAGTGGGGAGGACTGCCGG + Intronic
907872613 1:58456543-58456565 GGCTGAGTGAGGACGGCAGAAGG + Intronic
908556027 1:65257001-65257023 GGCAGGGGAGGGAGGGCATCAGG - Intronic
908775346 1:67634163-67634185 GGCTGAGGAGGGAGGATATCTGG + Intergenic
908782959 1:67708536-67708558 GGCTAAGGAGAGAGGGCAGCAGG - Intronic
909406623 1:75297383-75297405 GGCTGAGTTGGGAGGATGGCTGG - Intronic
910882556 1:91935315-91935337 GGCTGAGGAGGGAGGATTGCAGG + Intergenic
911050407 1:93666051-93666073 GGATGAGGAGGGAAGGCAGGAGG - Intronic
911731479 1:101296385-101296407 GGCTGAGAAGGGAGGGTGGCTGG - Intergenic
912179575 1:107202787-107202809 GTCTGACTACGGAGGTCAGCAGG - Intronic
912573014 1:110638232-110638254 GGCTGAGGAAGCTGGGCAGCAGG + Intergenic
912777274 1:112513603-112513625 TGAGGAGAAGGGAGGGCAGCTGG - Intronic
913206406 1:116543225-116543247 GGCTGAGTAGGGAGGGCAGCAGG + Intronic
914437418 1:147671995-147672017 GGATGAGGGGGGAGGTCAGCAGG + Intergenic
914870336 1:151468352-151468374 GGCTGAGGCGGGAAGGCTGCTGG + Intergenic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915090487 1:153420814-153420836 GGCTGCATAGAGAAGGCAGCAGG - Exonic
915131554 1:153698537-153698559 GGCTGAGAAGGCAGCTCAGCAGG + Intergenic
915262070 1:154684160-154684182 GGATGAGGAAGGAGGGCAGAAGG + Intergenic
915312377 1:155011105-155011127 GGCTTAGTGTGGGGGGCAGCAGG - Intronic
915507203 1:156365458-156365480 GGCTGAGCAGGAAGGGCAAATGG - Intronic
915916106 1:159941944-159941966 GGCTGAGCAGAGAGGGGAGGAGG - Intronic
916668485 1:166989537-166989559 GGGTGAGGCGGGAGGGCAGAAGG + Intronic
916992524 1:170259609-170259631 AGCTAAGTCGGGAGGGCACCTGG - Intergenic
917106850 1:171500997-171501019 GGCTGAGGTGGGAGGACTGCTGG - Intronic
918339064 1:183552255-183552277 AGCTGAGAAGGGAAGGCAGATGG + Intronic
918423375 1:184386326-184386348 GGCTGAGAAGGGTGGGGAGAGGG + Intergenic
918929792 1:190839864-190839886 GGCTGAGAAGGGAGGATAACTGG + Intergenic
919318007 1:195999650-195999672 GGGAGAGAAGGCAGGGCAGCAGG - Intergenic
919932372 1:202229667-202229689 GGCTCAGTGAGTAGGGCAGCAGG + Intronic
920294523 1:204947627-204947649 GGCTGGATAGGGAGGGAAGGAGG - Intronic
920372313 1:205486871-205486893 GGCTGAGGAGTGAGGGCAAAGGG - Intergenic
920422823 1:205847116-205847138 GGCTGAGGTGGGAGGGTTGCTGG - Intronic
920423633 1:205854621-205854643 GGCTGAGGTGGGAGGGTTGCTGG + Intergenic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
920958233 1:210639207-210639229 GGATGAGTTGGGAGGACAGAAGG - Intronic
921034902 1:211367620-211367642 AGCTGAGTAGGGAGGGGACATGG + Intronic
921055318 1:211538559-211538581 GGCTGAGCAGGGAAGAGAGCGGG + Intergenic
921293868 1:213683837-213683859 GGGTGAGGAGGGAGGGAGGCTGG - Intergenic
921706961 1:218333595-218333617 GGCTGAGGTGGGAGGATAGCTGG - Exonic
921741308 1:218688057-218688079 GGCTGAGGAGGCTGGACAGCAGG + Intergenic
922608688 1:226908235-226908257 GGCTGAGCGGGGAGCTCAGCAGG - Intronic
922818890 1:228470588-228470610 GGATGGGTGGGGAGGGGAGCTGG + Intergenic
923149709 1:231221957-231221979 GGCTGAGGAGGGAGGATCGCTGG + Intergenic
923305949 1:232688228-232688250 GGATAAGGAGAGAGGGCAGCCGG - Intergenic
923936848 1:238771041-238771063 GGCTGAGATGGGAGGATAGCTGG - Intergenic
923946839 1:238897933-238897955 GGGTGAATAAGGAGGGAAGCAGG + Intergenic
924028741 1:239865906-239865928 GACAGAGTAGGGAGGGGTGCGGG + Intronic
924219168 1:241855570-241855592 GGCTGAGGAGTGCGGGCAGACGG - Intronic
924386916 1:243507526-243507548 GGCTGCGGTGGGAGGGGAGCTGG + Intronic
1063562008 10:7137309-7137331 AGATGAATAGGGATGGCAGCAGG - Intergenic
1064156211 10:12905442-12905464 GGATGGGTTTGGAGGGCAGCTGG + Intronic
1064401870 10:15028252-15028274 GGCTGAGGTGGGAGTGTAGCGGG - Intergenic
1064511075 10:16092067-16092089 GGCTGAGTTGGGAGGACTGCTGG + Intergenic
1065025875 10:21538540-21538562 GGTCGAGTTGGGAGGGCTGCTGG - Intronic
1065694422 10:28366794-28366816 GGCTGAGGTGGGAGGATAGCTGG + Intergenic
1065812154 10:29452139-29452161 GGCTGAGCTGGGAGGACTGCTGG - Intergenic
1066087828 10:31988477-31988499 GGGTGAGGAGGGAGAGCATCAGG + Intergenic
1066294880 10:34045227-34045249 GGGTGAGGAGGGAGAGCATCAGG - Intergenic
1066316007 10:34246984-34247006 GGCTGAGGTGGGAGGACTGCTGG + Intronic
1066658215 10:37713842-37713864 GGCTGGGGAGGGAGGGAAGTGGG - Intergenic
1067808966 10:49412404-49412426 TGCTGAGTAGGGTGAGCAGTGGG - Intergenic
1068685755 10:59868568-59868590 ACCTCAGTAGGGAGGGCACCAGG - Intronic
1069045059 10:63734904-63734926 GGCTGAGTGGGGAGGATGGCTGG - Intergenic
1069553107 10:69378138-69378160 GGCTGGGAAGGAAGGGGAGCGGG + Intronic
1069594806 10:69663742-69663764 GGCAGAGGGTGGAGGGCAGCTGG - Intergenic
1069957091 10:72058813-72058835 GGCTGAGAAGGAGGGGCAGTGGG - Intergenic
1070042486 10:72795291-72795313 GACTGAGAAGGGATGGCAGGTGG - Intronic
1070257425 10:74824876-74824898 GGCTGAGGCGGGAGGGGGGCGGG - Intergenic
1070541245 10:77416978-77417000 TGACGAGTGGGGAGGGCAGCCGG - Intronic
1070577507 10:77690496-77690518 GCCTGAGGCGGGATGGCAGCAGG + Intergenic
1070577513 10:77690513-77690535 AGCAGGCTAGGGAGGGCAGCAGG + Intergenic
1070844835 10:79513472-79513494 GGATGAGTGGGGAGGGCACAAGG - Exonic
1070928970 10:80246835-80246857 GGATGAGTGGGGAGGGCACAAGG + Intergenic
1071523719 10:86346404-86346426 GCCTGTGTTTGGAGGGCAGCTGG + Intronic
1073432389 10:103494609-103494631 GGCTGGGGGTGGAGGGCAGCCGG + Intronic
1073837141 10:107457157-107457179 GGCTGAGGTGGGAGGACTGCCGG + Intergenic
1073855109 10:107664441-107664463 AGCTGAGGAGGAAGGGGAGCTGG - Intergenic
1074078373 10:110149607-110149629 TGCTGAGAAGGGAGGGGAGTAGG - Intergenic
1074431790 10:113400809-113400831 GGCAGAAGAGGGAGGGCAGGGGG + Intergenic
1075031797 10:119029297-119029319 GGCCGGGAAGGGAGGGCCGCTGG - Intergenic
1075278054 10:121113034-121113056 AGCTGAGGCTGGAGGGCAGCAGG + Intergenic
1075625761 10:123963517-123963539 GGATGAGAAGGGAGGGAAGCTGG - Intergenic
1075841505 10:125508581-125508603 GGCTGAGTAGGGAGGCTGGAAGG - Intergenic
1076314902 10:129533120-129533142 GGCACAGCAGGCAGGGCAGCTGG - Intronic
1076610485 10:131723078-131723100 GGCAGAGGTGGGAGGGCAGGAGG - Intergenic
1076676971 10:132152135-132152157 GCCTGAGTCAGGAGTGCAGCTGG + Intronic
1077138885 11:1014839-1014861 AGCTGGGAGGGGAGGGCAGCTGG - Intronic
1077159676 11:1107049-1107071 GGGTGAGTAGAGAGGACAGGTGG - Intergenic
1077248848 11:1551805-1551827 GGATGAGTGGGGTGGGCAGGTGG - Intergenic
1077488905 11:2851493-2851515 TCCTGAGTAGGGAGGGGGGCTGG - Intergenic
1077491534 11:2863007-2863029 GGCTGAGGAAGGCGGGCCGCGGG - Intergenic
1077492972 11:2870567-2870589 GGCTGAGTCGGCAGGGACGCAGG + Intergenic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1080461531 11:32459008-32459030 GGCTGAGTAGGGAGGTTATGGGG - Intergenic
1080600884 11:33819811-33819833 GGCTGAGGAAGGAGGGCACAAGG - Intergenic
1080666047 11:34337261-34337283 GGCTGTGTAGGGAAGGAGGCAGG + Intronic
1080776974 11:35395101-35395123 CCCTGAGTAGGGAGGGCAGTGGG + Intronic
1080779923 11:35420017-35420039 GGCGGGGGAGGGAGCGCAGCTGG - Intronic
1081693757 11:45095219-45095241 GGCTTAGAAGGGCTGGCAGCTGG - Intergenic
1081700571 11:45150065-45150087 TGCAGAGTCTGGAGGGCAGCTGG - Intronic
1081951611 11:47049084-47049106 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1081993511 11:47349962-47349984 GGGTGGGAAGGGGGGGCAGCAGG - Intronic
1083205541 11:61146581-61146603 GGAGGAGGAGGGAGGGCTGCGGG + Intronic
1083310094 11:61779575-61779597 GGGTGAGCAGGGATGGCAGGCGG + Intronic
1083747271 11:64743299-64743321 GGCTGTGGAGGGAGGGAAGCGGG - Intronic
1083779375 11:64910078-64910100 GGCGCAGTAGGGCGGCCAGCCGG + Exonic
1083811551 11:65109408-65109430 GGCAGAGGCGGGAGAGCAGCAGG - Exonic
1083925604 11:65804213-65804235 TGCTGGTTAGGGAGGGCAGGAGG - Intergenic
1083951480 11:65959031-65959053 GGCTGAGTGGGTAGGGAAGCAGG + Intronic
1084125562 11:67096759-67096781 GGCAGAGTTGGGAGGGCAGGAGG - Intergenic
1084182336 11:67453105-67453127 GGCTGAGATGGGAGGGTCGCTGG - Intronic
1084557886 11:69885706-69885728 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1084557892 11:69885720-69885742 GGCTGAGGGGGGAGGGCAGAAGG + Intergenic
1084557904 11:69885748-69885770 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1085212813 11:74796974-74796996 GGCTGAGTAGGTGGGGCTACAGG + Intronic
1085592371 11:77775697-77775719 GGCTGAGGAAGGAGGATAGCTGG + Intronic
1085719838 11:78903221-78903243 GGCTGAGGAGGGTGGGCACCCGG - Intronic
1086985521 11:93244808-93244830 GGCTGAGGAGGGAGGAAATCAGG - Intergenic
1088170087 11:106986698-106986720 GGCAGAGTAGGATGGGAAGCAGG + Intronic
1088921362 11:114261661-114261683 GGCTGAGTAAGGAGGGAATGTGG + Intronic
1089194592 11:116686849-116686871 GGCTGAGTGGTGGGGACAGCCGG + Intergenic
1089201330 11:116726286-116726308 GGCGGGGGAGGGTGGGCAGCGGG - Intergenic
1089215245 11:116830902-116830924 GGATGGGGAGGGAGGCCAGCGGG - Intronic
1089306922 11:117532322-117532344 GGCTGGGAAGGGAGGACACCAGG - Intronic
1089626969 11:119757504-119757526 GGCAGAGCAGTGAGGACAGCAGG - Intergenic
1090718270 11:129449791-129449813 GGCTGAGTGAGAGGGGCAGCAGG + Intronic
1090967689 11:131613258-131613280 GGATGGGTGGGGAGGGCATCAGG - Intronic
1091404178 12:198748-198770 GGCTGGGTGGGGAAGGCACCTGG + Intronic
1091917778 12:4281853-4281875 GGCTGAGCAGGGAAGGAAGGAGG - Intronic
1092208924 12:6633793-6633815 AGCAGAGTAGGGAGAGCAGATGG + Intronic
1092502203 12:9059778-9059800 GGCTGAGGTGGGAGGATAGCTGG - Intergenic
1092598069 12:10029612-10029634 TGCTGAGTAGGTAGGGCACAGGG - Intergenic
1093471366 12:19505603-19505625 GGCAGAGTAGGCAGCGTAGCTGG + Intronic
1093583185 12:20807383-20807405 GGCTGAGGAGGGCGGGGCGCAGG - Intergenic
1093999618 12:25680877-25680899 GGCTGAGTTGGGAGGATTGCTGG + Intergenic
1094144505 12:27214405-27214427 GGCAGAGGAGGTAGGGCAGGAGG + Intergenic
1095431013 12:42134605-42134627 GTCTGAGTAGGGAGGGAAATGGG - Intronic
1096413838 12:51395681-51395703 AGGTTAGTAGGGAGGCCAGCTGG + Intronic
1096531500 12:52245441-52245463 GGCTGAGGAGCGTGGGGAGCTGG + Exonic
1096801867 12:54115718-54115740 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1096829260 12:54301539-54301561 GGCTGAGGGGGGAGGGGAGAAGG - Intronic
1098089433 12:66885321-66885343 TGCAGAGCAGGGAGGGGAGCTGG + Intergenic
1098090160 12:66892864-66892886 GGCTGAGTCGGGAGGATTGCTGG + Intergenic
1100406250 12:94275134-94275156 TTCTGAGTAGGGAGGACAGTGGG - Intronic
1100891432 12:99130582-99130604 GGATGAGTAGAGAGGGAAGAAGG - Intronic
1101939682 12:109090634-109090656 GGCTGAGGCAGGAGGGCTGCTGG - Intronic
1102049553 12:109852780-109852802 GGCTGAGGAGCCAGGCCAGCAGG + Intronic
1102153551 12:110705740-110705762 GGCTGAGGTGGGAGGGTAGGAGG + Intergenic
1102405874 12:112673812-112673834 GGCTGTGTGGGGAGGGAAGTAGG - Intronic
1102509260 12:113403225-113403247 GGCTGAGTTGGGAGGATCGCTGG - Intronic
1102567064 12:113803652-113803674 GGCTGGGGTTGGAGGGCAGCTGG + Intergenic
1102703141 12:114857567-114857589 GCCTGAGGATGGAGGGCAGGAGG - Intergenic
1103075005 12:117974910-117974932 GGGTGCGGAGAGAGGGCAGCAGG - Intergenic
1103135279 12:118501735-118501757 GGCTGAGTAGGGAGGATCACTGG + Intergenic
1103238867 12:119397704-119397726 GGCTGAGGAGTGCAGGCAGCGGG - Intronic
1103317344 12:120066942-120066964 GGCTGAGCAGGCAAGGCAACAGG + Intronic
1103458535 12:121086080-121086102 GGCAGCGTAGGGAGTGAAGCCGG + Intergenic
1103972752 12:124682318-124682340 GCCTGAGAAGGCAGGGAAGCTGG - Intergenic
1104115358 12:125744519-125744541 GGCTGAACCTGGAGGGCAGCGGG + Intergenic
1104400113 12:128468241-128468263 GGGTGTGCAGGGAGGGCAGGGGG + Intronic
1104855003 12:131897390-131897412 GCCTGAGAACGGAGGGCAGCGGG - Intronic
1104939165 12:132386819-132386841 GGCTGAGAAGGGAGGGCCGTGGG - Intergenic
1104975645 12:132550837-132550859 GGGAGAGTTGGGAGGGCAGGAGG + Intronic
1104985831 12:132596478-132596500 CGGTGAGTAGGACGGGCAGCGGG + Intergenic
1105796347 13:23857467-23857489 GGCTGAGGCAGGAGGGCTGCTGG + Intronic
1106179967 13:27362109-27362131 TGAGGAGTAGGGAGGGCAGTGGG + Intergenic
1106830798 13:33580384-33580406 GGCTTAGTGGGGAGGGGAGAAGG + Intergenic
1107389719 13:39951454-39951476 GGGGGAGGAGGGAGGGCAGGGGG + Intergenic
1107836183 13:44413945-44413967 GGCTGAGGAGTGAGGGCACACGG + Intergenic
1107860253 13:44653952-44653974 GGCTGAGGTGGAAGGGTAGCTGG - Intergenic
1112211371 13:97380850-97380872 GGCTTACTGGGGAGGGCAGATGG + Intronic
1112500697 13:99940825-99940847 GGCCGAGTTGCAAGGGCAGCGGG - Intergenic
1112610807 13:100952942-100952964 GGATGAATAGAGAGGGCAGCAGG - Intergenic
1113185612 13:107683025-107683047 GGCTGAGGAGGGAGGATTGCCGG + Intronic
1113414371 13:110116886-110116908 GGCTGGGCAGAAAGGGCAGCAGG + Intergenic
1113717711 13:112524943-112524965 GGCCAAGTCGGAAGGGCAGCAGG - Intronic
1113834125 13:113317785-113317807 GGCTGACTAGGGAGGGTCACTGG - Intronic
1113876430 13:113597579-113597601 TGCCCTGTAGGGAGGGCAGCTGG - Intronic
1113939413 13:114010663-114010685 GGCTGCGTGGGGAGGGAAGTGGG + Intronic
1114263238 14:21054545-21054567 GACAGAGTGGGGATGGCAGCAGG - Intronic
1114550722 14:23531431-23531453 AGCTGGGCAGGGAGGGCAGCAGG - Intronic
1114616312 14:24070303-24070325 GGATGAGTGGGGAAGGCATCAGG - Intergenic
1115176247 14:30564431-30564453 AGCTGAGGTGGGAGGACAGCTGG - Intronic
1115261879 14:31462619-31462641 GGCTGAGGTGGGAGGGTTGCTGG + Intergenic
1115742002 14:36398460-36398482 GAAGGAGTAGAGAGGGCAGCAGG + Intergenic
1117161961 14:52998415-52998437 GGCTGCATAGGAGGGGCAGCTGG + Intergenic
1117415385 14:55490801-55490823 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1117432729 14:55685510-55685532 GGCAGAATAGGGAGGGCAGAAGG - Intronic
1117495201 14:56295475-56295497 GCCTCAGTAGGGAGGATAGCAGG - Intronic
1117871996 14:60210875-60210897 GGCTGAGTGGGGAGGATAGCTGG - Intergenic
1118845373 14:69544058-69544080 CTCTGAGTAGGGAGGTCAGTAGG + Intergenic
1120968400 14:90187427-90187449 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1121316558 14:92964403-92964425 GGGTGGGGAGGGAGGGGAGCTGG + Intronic
1121367066 14:93322997-93323019 ACCTGAGTAGCTAGGGCAGCAGG - Intronic
1121732125 14:96194307-96194329 TGCTGCATAGGGAGGGCAGAAGG + Intergenic
1122443898 14:101755381-101755403 GGGTGGGTAGGGAGGGCTACTGG - Intergenic
1122800887 14:104228978-104229000 GGCTGTGGAGGGGGAGCAGCGGG + Intergenic
1122805418 14:104253927-104253949 GGGTGAGAAGGGAGGGGAGCAGG + Intergenic
1122878506 14:104679541-104679563 GAATGCCTAGGGAGGGCAGCTGG - Intergenic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1122972278 14:105157214-105157236 GGCTGTGCAGGGGGAGCAGCCGG - Intronic
1123022019 14:105403521-105403543 GGCTGAGGTGGGAGGATAGCTGG - Intronic
1123038417 14:105480618-105480640 GGCTGAGGAGGGAAGGGGGCCGG + Intergenic
1123494110 15:20807266-20807288 GGCTGAGCAGGGTGGGGGGCAGG + Intergenic
1123706636 15:22955521-22955543 GGCTGGGGAGGCAGGGGAGCAGG + Intronic
1124018005 15:25894449-25894471 GGGTTGGTGGGGAGGGCAGCAGG - Intergenic
1124145941 15:27125339-27125361 GGCTGAGAAGGGAAGGGAGGAGG + Intronic
1124783205 15:32655531-32655553 TGCTGACTTGGGAGGGCAACGGG + Intronic
1125569506 15:40705043-40705065 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1126933546 15:53681275-53681297 GGCAGCGTGGGGAGGGCAGATGG + Intronic
1127869785 15:63061779-63061801 GGCTGAGAAGGTAGGCCAGGAGG + Intronic
1128162587 15:65434099-65434121 AGCTGAGGAGGGAGAGCAGGAGG - Intergenic
1128745188 15:70109331-70109353 GGCACAGTAGGGAGGTCTGCTGG - Intergenic
1128762446 15:70226572-70226594 AGCTGAGAAGGAGGGGCAGCAGG - Intergenic
1129874188 15:78961804-78961826 GGCTGGGGAGGGACGGAAGCAGG + Exonic
1129937862 15:79465750-79465772 GCCAGGGTAGGGAGGGCTGCTGG + Intronic
1130149942 15:81303810-81303832 GGCTGCGTGGAGAGGGTAGCAGG + Intronic
1130635871 15:85619335-85619357 GGCTGGCTAGGGAGGGAAGGAGG + Intronic
1130905128 15:88234858-88234880 GGCTGAGTAGGGTGCGCTGGTGG - Intronic
1130908180 15:88254359-88254381 GGGTCAGCAGGGAGGGCAGGAGG - Intronic
1131087342 15:89588200-89588222 GGCTGAGGAGAGAGGGGAGGAGG + Intronic
1131428624 15:92368189-92368211 GGCAGATCTGGGAGGGCAGCAGG - Intergenic
1131957166 15:97748756-97748778 GGCTGTGCAGGGAGGGGAGGTGG - Intergenic
1132101252 15:99024983-99025005 GGCTGAGGTGGGAGGATAGCTGG - Intergenic
1132302929 15:100787685-100787707 GGGTGTGTGGGGAAGGCAGCAGG - Intergenic
1202958949 15_KI270727v1_random:103602-103624 GGCTGAGCAGGGTGGGGAGCAGG + Intergenic
1132715115 16:1286263-1286285 GGCTGAGACGGGGGAGCAGCAGG + Intergenic
1132859834 16:2064715-2064737 GGCTGGGCAGGGAGGACGGCAGG - Intronic
1132899919 16:2247805-2247827 GGCTGAGTTGGGAGGATCGCTGG - Intronic
1133810878 16:9160259-9160281 GGCTGAGAAGTGAACGCAGCTGG - Intergenic
1134188259 16:12100844-12100866 GGGACAGCAGGGAGGGCAGCTGG + Intronic
1134297478 16:12959810-12959832 GGCTGAAAGGCGAGGGCAGCAGG - Intronic
1134522807 16:14926294-14926316 GCCTGCGTAGGGGGAGCAGCGGG + Intronic
1134710476 16:16324945-16324967 GCCTGCGTAGGGGGAGCAGCGGG + Intergenic
1134718649 16:16369233-16369255 GCCTGCGTAGGGGGAGCAGCGGG + Intergenic
1134754631 16:16655867-16655889 AGCTGAGGAGGAATGGCAGCGGG - Intergenic
1134949127 16:18343700-18343722 GCCTGCGTAGGGGGAGCAGCGGG - Intergenic
1134956105 16:18382926-18382948 GCCTGCGTAGGGGGAGCAGCGGG - Intergenic
1134991430 16:18703175-18703197 AGCTGAGGAGGAATGGCAGCGGG + Intergenic
1135429896 16:22374339-22374361 GGCTGAGGCGGGACGGCGGCGGG - Exonic
1135531347 16:23257570-23257592 GCCTGAGTAGCTCGGGCAGCAGG + Intergenic
1135566946 16:23518307-23518329 GGCTGAGGTGGGAGGATAGCTGG - Intronic
1137279680 16:46965115-46965137 GGCTGAGGAGGGAGGACTGCTGG + Intronic
1137699832 16:50489455-50489477 GGCTGGGTGGGGAGAGCACCCGG + Intergenic
1137758360 16:50920279-50920301 GGCTGTGTGAAGAGGGCAGCTGG + Intergenic
1137905835 16:52321036-52321058 GGCTGAGAAGGGAAGGATGCTGG + Intergenic
1138111924 16:54330726-54330748 GGCTGAGAAGAGAGGAAAGCAGG - Intergenic
1138555081 16:57766236-57766258 GGGTGAAAAGGGAGGGCAGGTGG - Intronic
1139222237 16:65195435-65195457 GGCTGAGTAGGGAGAGGGGATGG - Intergenic
1139461107 16:67123210-67123232 GGCTGAGGTGGGAGGACGGCTGG - Intronic
1139750007 16:69104067-69104089 GGCTGAGGCGGAAGGGCTGCTGG + Intergenic
1140476062 16:75239768-75239790 AGCTGGGGAGGGAGGGGAGCGGG - Intronic
1141373559 16:83509037-83509059 GAATGAGAAGGGAGGGCAGAGGG - Intronic
1141591610 16:85073051-85073073 GGCTGGGTGGGGAGGGAGGCAGG - Intronic
1141766695 16:86063786-86063808 GCCTGAGCAGGGAGGGTAGAGGG + Intergenic
1142157344 16:88538591-88538613 GGAGGAGTAGAGAGGGCATCAGG - Intergenic
1142178850 16:88657517-88657539 AGCTGAGGCTGGAGGGCAGCGGG + Exonic
1142249908 16:88986483-88986505 GGCAGAGTTGGGAGTGGAGCGGG - Intergenic
1142283701 16:89162206-89162228 GGCAGAGGAGGGTGGGCAGGTGG - Intergenic
1142489388 17:268255-268277 GGCTGAGGAGGAAGGGGAGTTGG - Intronic
1142504473 17:354027-354049 GGCTGAGGTGGGAGGGTGGCTGG + Intronic
1142669161 17:1479571-1479593 GGGTGAGTGGGGCGGGCAGAGGG - Exonic
1142669711 17:1482598-1482620 GGCGGGGTGGGGAGGGCAGGGGG - Intronic
1142805148 17:2367542-2367564 GGCAGATCAGGGAGGGCAGAAGG + Intronic
1142809523 17:2388756-2388778 GACTGAGTGTGGAGGGGAGCTGG - Intronic
1143258852 17:5583762-5583784 GGCTCAGTATGGGGAGCAGCGGG - Exonic
1143495823 17:7312173-7312195 GGATGAGTGGGGAGGGCACAAGG - Exonic
1143497764 17:7322256-7322278 GGCTGAGGTGGGAGGATAGCTGG - Intronic
1143517879 17:7429093-7429115 GGCTGAGGTGGGAGGGCTGTTGG + Intergenic
1143610421 17:8014783-8014805 GGGTGGGCTGGGAGGGCAGCTGG + Intronic
1144051411 17:11500181-11500203 GACTGAGGATGGAGAGCAGCAGG - Intronic
1145004918 17:19332377-19332399 GGTGGAGTAGGGTGGGCTGCTGG + Intronic
1145043892 17:19597057-19597079 GTGTGAGTTGGGAGGGCAGAAGG + Intergenic
1145105249 17:20110070-20110092 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1145122213 17:20270097-20270119 GGCTGAGGAGAGAGGGCAATAGG + Intronic
1145973069 17:28968288-28968310 GGCTGACGAGGGAGGGCTTCTGG + Intronic
1146273154 17:31497697-31497719 GGCTGAGTTGGGGAGGCACCAGG + Intronic
1146346592 17:32064077-32064099 GGCTGAGGTGGGAGGATAGCTGG + Intergenic
1146455876 17:33009343-33009365 GGCATAATAGGGAAGGCAGCAGG - Intergenic
1147120854 17:38334371-38334393 GGCTGAGGAGTGAGGGGAGAAGG + Intronic
1147215424 17:38896381-38896403 GGCTGAGAAGGGAGGGAGCCTGG - Intronic
1147382797 17:40065629-40065651 GGCTGCGCAGGGGGGGCAGAGGG - Intronic
1147907281 17:43831636-43831658 GTCTGAGCTGGGAGGTCAGCAGG + Exonic
1148026697 17:44593688-44593710 GGCTGGGATGGGAGGGCAGGGGG - Intergenic
1148737044 17:49870824-49870846 GGCTGAGCAGGAAGGGGAGAGGG - Intergenic
1148865133 17:50624339-50624361 GCCTGTGGAGGGAGGGAAGCGGG - Exonic
1148888566 17:50791122-50791144 GGCTGAGGTGGGAGGGTTGCTGG + Intergenic
1149257747 17:54846228-54846250 GGCTGAGGAGGGAGGGAATGGGG - Intergenic
1149548216 17:57519954-57519976 GGCTGAGTCGGGAGGATCGCTGG + Intronic
1149564177 17:57629850-57629872 GCCTGATTACGGAGGGGAGCAGG - Intronic
1149821195 17:59779373-59779395 TGCTGAGTAGGGATGGGACCTGG + Intronic
1150648279 17:66993307-66993329 GGCTGGGTAGGCAGGGCCACTGG + Intronic
1151351909 17:73536827-73536849 GGCGGAGTAGGGAAGGAGGCGGG - Intronic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151974268 17:77475602-77475624 GCCTGCAGAGGGAGGGCAGCTGG + Intronic
1152070971 17:78133477-78133499 GGCTGAGGAGGTAGGCCAGGCGG - Exonic
1152075778 17:78158861-78158883 GGATGAGTGGGGAGGGCACAAGG - Intronic
1152259513 17:79259531-79259553 GCCTGAGGAGGGAAGGGAGCAGG + Intronic
1152322428 17:79615420-79615442 GGGAGAGGAGGGAGGGCAGGAGG + Intergenic
1152558819 17:81067786-81067808 GCCAGAGCAGGGAGGACAGCTGG + Intronic
1152693267 17:81731333-81731355 GGCTGGGGAGGGAGGGATGCGGG + Intergenic
1152843237 17:82583736-82583758 AGCTGCTTAGAGAGGGCAGCTGG + Intronic
1152947175 17:83204136-83204158 GGCTGTGTATGGGGGGAAGCTGG + Intergenic
1153317611 18:3740473-3740495 GGCAGAGTAGGGAGGGAGCCAGG - Intronic
1153747055 18:8190268-8190290 GGCTGTGTGGGGAGGGAGGCTGG - Intronic
1153794324 18:8609231-8609253 GGCGGAAGAGGGAGGGAAGCGGG + Intergenic
1154340137 18:13496022-13496044 GGCAGAGAAGGGAGGCCAGGCGG - Intronic
1154451640 18:14481724-14481746 GGCTGAGCAGGGTGGGGGGCAGG + Intergenic
1154963192 18:21330131-21330153 GGCTGGGCAGGCAGGTCAGCTGG + Intronic
1155508280 18:26551095-26551117 CGCCCAGTAGGGAGGGGAGCTGG - Intronic
1156140873 18:34109416-34109438 GGCTGAGGTGGGAGGATAGCTGG + Intronic
1156449403 18:37258581-37258603 AGGTGAGTGGGGAGGGCAGGAGG + Intronic
1156555506 18:38063339-38063361 AGATGAGAAGGGAGGGCACCAGG + Intergenic
1156913493 18:42438812-42438834 GGCTGGGGAGGGAGAGCATCAGG - Intergenic
1157100206 18:44722348-44722370 GTGTGAGAAGGTAGGGCAGCAGG - Intronic
1157682841 18:49620372-49620394 GGCTGTGAAGGCAAGGCAGCGGG - Intergenic
1157738210 18:50069560-50069582 GGCTGAGGAGTGAGGGCAACGGG - Intronic
1157890487 18:51411333-51411355 AGCTGTGTAGGGAGGGCTGTGGG + Intergenic
1158316046 18:56212344-56212366 GCATGAGCAAGGAGGGCAGCAGG - Intergenic
1158616284 18:58990790-58990812 GCCTGAGTAGGGGTGGAAGCTGG + Intergenic
1158810491 18:61028149-61028171 GGCTGAGATGGGAGGACTGCTGG + Intergenic
1159051242 18:63422782-63422804 GGATGAGGAGGGAAGGGAGCCGG - Intergenic
1159588261 18:70302658-70302680 AGCTGAGTAGGAAGGGAAGAGGG + Intronic
1159935343 18:74361283-74361305 GGCGGAGTAGGGAGGGAGGAAGG + Intergenic
1159973768 18:74685441-74685463 TGCTGAGGAGGGAGGACAGAGGG - Intronic
1160123941 18:76153671-76153693 GGCTGGGTAGAGAAGGCAGCAGG + Intergenic
1160378314 18:78430156-78430178 GGCTGGGCTGGGAGGGCTGCTGG - Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1160696255 19:486038-486060 GGATGAGGATGGAGGGGAGCTGG - Intergenic
1160896641 19:1405776-1405798 GGCTGAGGAGGGAGGATAGCTGG + Intergenic
1160900791 19:1427293-1427315 GGCTGCCCAGGGACGGCAGCAGG - Intronic
1160944165 19:1633463-1633485 GGATGAGCAGGGAGGGCAGGGGG - Intronic
1161002263 19:1916691-1916713 GGCTGAGGCAGGAGGGCTGCTGG - Intronic
1161106401 19:2445925-2445947 GGCTGGTTGGGGGGGGCAGCTGG - Intronic
1161426918 19:4208743-4208765 GGCTGGGGAGAGAGGGAAGCAGG - Exonic
1161426982 19:4209017-4209039 GGCTGGGGTGGGAGGGCAGTGGG + Intronic
1161633407 19:5370927-5370949 GGCTGAGGAGGGAGGATCGCTGG - Intergenic
1161785968 19:6325757-6325779 GGCTGAGACGGGAGGACTGCTGG + Intronic
1161984487 19:7646221-7646243 GGCAGGGCAGGGAGGGCAGCAGG - Intronic
1162109525 19:8392482-8392504 GCCAGTGTGGGGAGGGCAGCAGG - Intronic
1162111848 19:8403795-8403817 GGCGGGGTGGGGAGGGCGGCAGG + Exonic
1163318075 19:16555115-16555137 GGCTGGGCAGGGAAGGAAGCCGG - Intronic
1163406023 19:17122985-17123007 GGTTGAGGTGGGAGGGCCGCAGG + Intronic
1163535586 19:17874451-17874473 GGGTGAGCAGGGAGGGCGTCTGG - Intronic
1163553581 19:17979964-17979986 GGCTGAGGAGGGAGGACTGCTGG + Intronic
1163560308 19:18015332-18015354 GGCTGAGGCGGGAGGACTGCTGG - Intergenic
1164305717 19:24002847-24002869 GGCCGAGGAGGGAGGGCGGTTGG + Intergenic
1164953476 19:32359961-32359983 GGCTGAGGTGGGAGGACTGCCGG - Intronic
1165006680 19:32813073-32813095 GGCTGAGTAAGGAGGATCGCTGG + Intronic
1165078910 19:33296700-33296722 GGCTGTGAGGGGAGGGAAGCTGG - Intergenic
1165378671 19:35462093-35462115 GGCTGAGGAGGGAGGACTGTTGG + Intergenic
1165466919 19:35980195-35980217 GGCTGAGTAGGGAGGATCACTGG + Intergenic
1165752394 19:38268194-38268216 CTCTGAGTAGTGAGGGCAGGTGG + Intronic
1166326518 19:42054218-42054240 GGAAGAGCAGGGAGGGCAGAGGG + Intronic
1166713512 19:44951933-44951955 GGCTGAGGTGGGAGGGATGCCGG - Intronic
1166743640 19:45129655-45129677 GGGTGAGTGGGGAGGGCACAAGG - Intronic
1166784459 19:45359354-45359376 GGCTGGGTAGCGAGGCCGGCTGG - Intronic
1166862359 19:45817762-45817784 AGGTGATGAGGGAGGGCAGCTGG - Intronic
1167267071 19:48488538-48488560 GGCTGAGGAGAGATGGCAGGGGG - Intronic
1167423967 19:49420259-49420281 GGATGAGAATGGAGGCCAGCAGG + Intergenic
1167426417 19:49432056-49432078 GGCTGAGAAGGGAGGATCGCTGG - Intronic
1167506012 19:49871509-49871531 GGGGAGGTAGGGAGGGCAGCTGG - Intronic
1167539919 19:50079269-50079291 GGCTGGGAAGGGAAGGCAGTGGG - Intergenic
1167587410 19:50382829-50382851 AGCTGGGGAGGGAGGGCAGCCGG - Exonic
1167629783 19:50618499-50618521 GGCTGGGAAGGGAAGGCAGTGGG + Intergenic
1167750771 19:51378972-51378994 GGCTGAGGTGGGAGGGTCGCTGG - Intergenic
1168354118 19:55691576-55691598 GGATGAGGAGGGAGGCCAGGTGG + Intronic
924991780 2:318725-318747 GGCTGAGTGGCGAGGGAGGCCGG + Intergenic
925055800 2:856496-856518 GGCTGGGCAGGGAGGAGAGCAGG - Intergenic
925978716 2:9159555-9159577 GGCTGAGCAGGGAGGTCACCTGG + Intergenic
926168393 2:10535769-10535791 GGCAGAGTGCGGAGGGCAGATGG + Intergenic
927515956 2:23671808-23671830 GGCTGGGGATGGAGGGCAGCGGG + Intronic
927907618 2:26872165-26872187 GGCTGAGGAGAGAGGAGAGCAGG + Intronic
927940956 2:27102505-27102527 GGGTGAGTAGGGTGGGCCGGGGG - Exonic
928027547 2:27752510-27752532 GGCTGGGAAGGGAAGGCTGCAGG + Intergenic
928097604 2:28413979-28414001 GGCTCAGAGGGGTGGGCAGCAGG - Exonic
928280067 2:29938143-29938165 ACCTGAGAAGGGAGGGCAGGGGG + Intergenic
928316053 2:30247054-30247076 GGCTGAGGTGGGAGGACTGCTGG - Intronic
928324908 2:30311510-30311532 GGGTCATTTGGGAGGGCAGCTGG + Intronic
929554437 2:42916573-42916595 GGCTGAGTAGGGAGGGCAATTGG + Intergenic
929777260 2:44937215-44937237 GGCAGTGCAGGGAGGGGAGCGGG - Intergenic
929779137 2:44946542-44946564 GCCTGAGTGGGGAAGGCAGGAGG + Intergenic
930708186 2:54524752-54524774 GGCTGAGTCTAGTGGGCAGCGGG - Intronic
930769606 2:55118362-55118384 GGCTGAGTTGGGAGGATCGCTGG + Intergenic
930807592 2:55506800-55506822 GGCTGAGGCAGGAGGGCAGGAGG - Intergenic
931358672 2:61559338-61559360 GGCTGAGGTGGGAGGATAGCTGG - Intergenic
932128998 2:69170329-69170351 GGCAGAGTAGGGTGGAGAGCTGG + Intronic
932139546 2:69263471-69263493 GGCTGATGAGAGAGGCCAGCTGG - Intergenic
932750249 2:74366920-74366942 TCCTGAGTAGGGTGGGCAGGAGG - Exonic
932896967 2:75649728-75649750 GACTGAGTAGGGAGGGGCCCAGG - Intronic
933486871 2:82935325-82935347 TAATGAGTAAGGAGGGCAGCTGG - Intergenic
933690933 2:85179012-85179034 GGCTGATAAGGGAGGGCTCCTGG + Intronic
934793008 2:97078896-97078918 GGGTGAGGAGGGAGAGCATCAGG - Intergenic
934813179 2:97301589-97301611 GGGTGAGGAGGGAGAGCATCAGG + Intergenic
934824516 2:97406891-97406913 GGGTGAGGAGGGAGAGCATCAGG - Intergenic
934856195 2:97731904-97731926 CAGTGAGGAGGGAGGGCAGCTGG - Intronic
935174558 2:100638446-100638468 GGCAGAGAGGGGAGGGCTGCAGG - Intergenic
935368476 2:102319922-102319944 GGCTGAGGTGGGAGGACTGCTGG - Intronic
935692725 2:105745191-105745213 GGCGGAGTTGGGAGCGCGGCGGG + Intronic
936020080 2:108988221-108988243 GGCTGGGCAGGGAGGTCAGCAGG - Intronic
936285656 2:111179161-111179183 GTCTGGGGAGGGAGGACAGCCGG + Intergenic
938228000 2:129634345-129634367 GGCTGAGGTGGGAGGGTGGCTGG + Intergenic
938299040 2:130197384-130197406 GGCTGAGGCGGGAGGACTGCTGG + Intronic
938457681 2:131477136-131477158 GGCTGAGGTGGGAGGGCTGCTGG - Intronic
938480039 2:131654298-131654320 CGCTGAGCAGGGTGGGCGGCAGG - Intergenic
938559882 2:132462455-132462477 GGCAGAGTAGGGAGGGGAAGTGG + Intronic
938816715 2:134912098-134912120 GGCTGAGAAGGGTGGGCGGAGGG - Intergenic
940859080 2:158753725-158753747 GGCTGACTTGGGAGAGGAGCCGG + Intergenic
941497932 2:166230449-166230471 AACATAGTAGGGAGGGCAGCAGG - Intronic
941604496 2:167580555-167580577 GGCTGGGTAGGGAGGACACAGGG - Intergenic
942537974 2:176985399-176985421 GAATGAGCAGGTAGGGCAGCAGG - Intergenic
942685257 2:178523815-178523837 GGCTGAGGAGGGATGGAAGAGGG - Intergenic
943304989 2:186249638-186249660 GGCTGAGGTGGGAAGGCTGCTGG + Intergenic
944081450 2:195793028-195793050 GGCTGAGGAGGGAGGATCGCTGG - Intronic
944268609 2:197755745-197755767 GGCTGGGAAGGGAGAGCATCAGG + Intronic
944361749 2:198865332-198865354 GGGTGGGCAGGGAGGGCAGCTGG - Intergenic
945731424 2:213541179-213541201 GTCTGAGTAGTGAGAGCAGTAGG + Intronic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946256939 2:218449268-218449290 GGCAGAGCAGAGAAGGCAGCTGG - Exonic
946306535 2:218859768-218859790 GGCGGAGGTGGGAGGGGAGCGGG - Intergenic
946310186 2:218878964-218878986 GGGAGAGTGGGGAGGGCAGGGGG + Intergenic
946580363 2:221121675-221121697 GGCTGAGGTGGGAGGGTTGCTGG - Intergenic
947406242 2:229780545-229780567 GACTGAGCAGGGTGGGCAGAGGG - Intronic
947868615 2:233419400-233419422 TTCTGAGCAGGAAGGGCAGCAGG + Intronic
948246972 2:236494894-236494916 GCCTGAGGAGAGAGGGCAGTAGG + Intronic
948617729 2:239212271-239212293 GGCTGAGCTGGGCGGGCAGGGGG + Intronic
948636830 2:239343673-239343695 GGCAGGGCAGGCAGGGCAGCAGG - Intronic
948840252 2:240645255-240645277 GGCTGAGAATGTAGGGCAGGAGG - Intergenic
948906487 2:240982067-240982089 GGCTGTGCACAGAGGGCAGCAGG + Intronic
948917011 2:241039528-241039550 CGGTGAGGAGGGAGGGCAGAGGG + Intronic
949032878 2:241805281-241805303 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949032894 2:241805320-241805342 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949032909 2:241805359-241805381 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949032925 2:241805398-241805420 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033069 2:241805741-241805763 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033146 2:241805932-241805954 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033189 2:241806035-241806057 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033205 2:241806074-241806096 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033281 2:241806257-241806279 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033297 2:241806296-241806318 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033313 2:241806336-241806358 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033408 2:241806565-241806587 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033424 2:241806604-241806626 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033470 2:241806717-241806739 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033517 2:241806830-241806852 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033533 2:241806869-241806891 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033549 2:241806908-241806930 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033564 2:241806947-241806969 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033640 2:241807134-241807156 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033656 2:241807173-241807195 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033687 2:241807251-241807273 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033702 2:241807290-241807312 GGCTGAGGCGGGAGGGAAGGTGG - Intergenic
949033716 2:241807329-241807351 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033810 2:241807562-241807584 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033877 2:241807726-241807748 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033892 2:241807765-241807787 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
949033993 2:241808007-241808029 GGCTGAGGGGGGAGGGAAGGTGG - Intergenic
1168840552 20:907340-907362 GGCTGCAGAGGGAGGGGAGCAGG + Intronic
1169254105 20:4084169-4084191 GGGTAAGTAGGGATGGCAGGAGG + Intergenic
1170134277 20:13055802-13055824 GGCTCAGGAGGGAGGGGAGTTGG + Intronic
1170465833 20:16621719-16621741 GGCTGAGGCGGGAGGACTGCTGG + Intergenic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171264943 20:23763582-23763604 GCCTGAGCATGGAGTGCAGCAGG - Intergenic
1171376223 20:24695941-24695963 GGCTGAGCATGGAGGGCTGGTGG - Intergenic
1171769598 20:29312215-29312237 GGCTGAGGAGGGAGGAAAGAAGG + Intergenic
1171794844 20:29558748-29558770 GGCTGTGTCTGAAGGGCAGCAGG - Intergenic
1171853612 20:30325517-30325539 GGCTGTGTCTGAAGGGCAGCAGG + Intergenic
1171989053 20:31681538-31681560 GGCTGAGGTGGGAGGACTGCTGG + Intronic
1172332569 20:34085608-34085630 AGCCGAGTAGGAAGAGCAGCAGG - Intronic
1172393503 20:34582577-34582599 GGCTGAGGTGGGAGGGTTGCTGG + Intronic
1172484810 20:35291803-35291825 GGCTGAAAAGGAAGCGCAGCAGG + Exonic
1172622432 20:36328326-36328348 TGCTGAGTAGGGCGTCCAGCTGG + Intronic
1172698340 20:36837230-36837252 GGCTGAGTTCTGAGGGCAGAGGG + Intronic
1173223909 20:41150658-41150680 GGATGAGAAGGGAGGGAAGATGG - Intronic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173461042 20:43243565-43243587 GTTTGAGCAGGGAGGGCAGTGGG - Intergenic
1173563691 20:44023924-44023946 GGCTGAGGAAGGAGGGAAGGGGG - Intronic
1173868255 20:46326599-46326621 TGCTGAGCAGGGAGGCCACCAGG + Intergenic
1173869349 20:46331810-46331832 GGCAGAGGAGGGAGGGCAGCTGG + Intergenic
1174175367 20:48641094-48641116 GGATGAGTAGGGTGGGTAGGTGG + Intronic
1174354351 20:49988270-49988292 TTCTGTGGAGGGAGGGCAGCTGG + Exonic
1174365845 20:50055765-50055787 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1174446912 20:50596687-50596709 GGCTGAGTGGGTCGGGCAGCAGG - Intronic
1174673014 20:52325251-52325273 TGGGGAGTAGGGAGGGCAGGTGG + Intergenic
1175132735 20:56801730-56801752 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1175204220 20:57299326-57299348 GGGTGAGGAGGGAGAGCATCAGG - Intergenic
1176444505 21:6808499-6808521 GGCTGAGCAGGGTGGGGGGCAGG - Intergenic
1176822670 21:13673537-13673559 GGCTGAGCAGGGTGGGGGGCAGG - Intergenic
1177555611 21:22684020-22684042 GGCTCAGTAGCTAGGTCAGCTGG - Intergenic
1177819138 21:26012106-26012128 GGCTGAGGTGGGAGGGTCGCTGG - Intronic
1178376372 21:32070873-32070895 GGCAGAGCAAGGAGGACAGCGGG + Intergenic
1178485947 21:33020253-33020275 GGCTCAGGCGGGAGGGCAGGCGG + Intergenic
1178512353 21:33216078-33216100 GGGTGGCTAAGGAGGGCAGCTGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178945753 21:36946340-36946362 GGCTGAGTTGGGAGGATTGCTGG - Intronic
1179252690 21:39686012-39686034 AGCTGAGCAGGAAGGGCTGCTGG - Intergenic
1179615430 21:42580225-42580247 TGCTGGGCCGGGAGGGCAGCTGG + Intronic
1179629224 21:42666357-42666379 GGGGAAGGAGGGAGGGCAGCTGG + Intronic
1180049535 21:45324973-45324995 GGCTGAGTCCGGGTGGCAGCTGG - Intergenic
1180139538 21:45884659-45884681 GGCTGAGGTGGGAGGACGGCTGG - Intronic
1181164254 22:20974907-20974929 GCATAAGCAGGGAGGGCAGCCGG - Intronic
1181174577 22:21028418-21028440 GGCTGCCTAGAAAGGGCAGCAGG - Exonic
1181492302 22:23268229-23268251 GGGTGCGTGGGGAGGGGAGCAGG + Intronic
1181610101 22:24006422-24006444 GGCTGGGAAGACAGGGCAGCTGG + Intergenic
1181962906 22:26635879-26635901 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1182537854 22:31019299-31019321 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1182878349 22:33711745-33711767 GGCTGAGGAAGGAGGACTGCTGG - Intronic
1182910886 22:33983274-33983296 AGCTGAAAAGGGAGGTCAGCTGG + Intergenic
1183586562 22:38756145-38756167 GGCTGAGCGCGCAGGGCAGCGGG - Intronic
1183702734 22:39458869-39458891 GGCTGGGCAGGGAGGCCAGGTGG + Intronic
1184666692 22:45992992-45993014 GGCTGAGATGGGAAGGCAGAAGG - Intergenic
1184817164 22:46881126-46881148 GGGTGGGTAGGGATGGCAGTAGG - Intronic
1185095410 22:48803625-48803647 GGCTGTTTGAGGAGGGCAGCTGG + Intronic
1185341564 22:50293484-50293506 GGCTGGGAGGGGAGGGCAGCAGG - Intronic
1185367902 22:50445385-50445407 GGCTGAGTGGGAGGGGCAGGTGG + Exonic
1185385324 22:50529246-50529268 GGCTCAGTCGGGACAGCAGCTGG - Exonic
1185409400 22:50674333-50674355 GCCTGAGACGGGAGGGAAGCGGG - Intergenic
949292820 3:2485280-2485302 GGCTGAGGAGGGCGGGCACGCGG + Intronic
949383093 3:3467549-3467571 GGCTGACTAGGGAGTACAACTGG + Intergenic
950010321 3:9718332-9718354 AGCAGAGCAGGGAGGGGAGCAGG + Intronic
950613443 3:14140446-14140468 GGGAGAGTTGGGAGCGCAGCAGG + Intronic
952573222 3:34742795-34742817 GGCAGAGTAGGAAGGGGACCAGG - Intergenic
952860011 3:37805282-37805304 GGCTGAGGTGGGAGGATAGCTGG - Intronic
952961102 3:38589604-38589626 GGCTGGGTAGGGAAGGCTCCTGG - Intronic
953461806 3:43087468-43087490 GGATGACTAGGGAGACCAGCAGG + Intronic
954316201 3:49803159-49803181 GGCGGAGTCGGGAGGGACGCCGG + Intergenic
954417307 3:50399633-50399655 GGCTGTGAAAGGAGGGGAGCAGG - Intronic
954569896 3:51631977-51631999 GGCTGAGAAGGGAGAGGAGGGGG - Intronic
954683797 3:52359776-52359798 GTCTGAGTTGGGAGGGGAGCAGG - Intronic
955744137 3:62123344-62123366 GGCTGAGACGGGAGGATAGCTGG - Intronic
956058379 3:65324773-65324795 TCCTGAGTAGGGAGGGCTCCTGG - Intergenic
956402145 3:68891503-68891525 GGCTGAGTACAGAAGGCACCAGG - Intronic
956750342 3:72339946-72339968 GGGTGAGGGGGGAGGGGAGCTGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957271223 3:78032651-78032673 GCCTAAGCAGGGAGGGCAGTGGG - Intergenic
959082152 3:101813341-101813363 GGCGGGGCAGGGAGGGCTGCGGG - Intronic
959697145 3:109260707-109260729 GGCTGAGAAGGGAGGAGAACGGG + Intergenic
961253051 3:125522645-125522667 GCCTGAGGTGGGAGGGTAGCTGG + Intergenic
961469314 3:127101339-127101361 GGCTGAGAAGGCAGGGCTGGCGG + Intergenic
961854888 3:129860303-129860325 GGCTGAGGTGGGAGGACTGCTGG - Intronic
962459025 3:135591698-135591720 AGCTGAGTTGGGAGGGGAGCAGG - Intergenic
962919291 3:139936066-139936088 AGCGGAGTAGGAAAGGCAGCGGG - Intronic
964556832 3:157949108-157949130 TGCAGAGCAGGGAGGGCTGCAGG - Intergenic
964895279 3:161588482-161588504 GGCTGAGGAGGGAGGATTGCTGG + Intergenic
965006471 3:163032666-163032688 TGCTGTGGAGGCAGGGCAGCAGG - Intergenic
967047740 3:185753296-185753318 GGCTGAGTAGAGGGGGCAGAAGG - Intronic
967088631 3:186116120-186116142 GGCAGAGAAGGGAGAGGAGCGGG - Intronic
967108446 3:186272398-186272420 GGCTAGGGTGGGAGGGCAGCTGG - Intronic
967214481 3:187198938-187198960 GGCTGAGTGGGGAGGGCTTGTGG + Intronic
968055463 3:195688275-195688297 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
968183190 3:196612451-196612473 GACTGAGTGGGGAGGGAGGCTGG - Intergenic
968256479 3:197277896-197277918 GGCTGAGGTGGGAGGACTGCTGG + Intronic
968549173 4:1213648-1213670 GGCTGGGTACGGAGGGGAGGTGG + Intronic
969278197 4:6151127-6151149 GTCACAGTTGGGAGGGCAGCAGG - Intronic
969486306 4:7474271-7474293 GGCTGGGCAGTGAGGTCAGCGGG + Intronic
969720050 4:8888548-8888570 GGTTGTGTAGGGAGGGCATTTGG - Intergenic
969741028 4:9026775-9026797 GGCTGAGGAGGGAGGACTGCTGG - Intergenic
969815737 4:9686041-9686063 GGCTGAGGTGGGAGGATAGCTGG + Intergenic
970756170 4:19429259-19429281 GGCAGAGATGAGAGGGCAGCTGG - Intergenic
970779918 4:19724515-19724537 GGCTGAGGAGGGAGAGCATTAGG - Intergenic
971261683 4:25062983-25063005 GGCTGTGGTGGGAGGGCAGTTGG + Intergenic
972434583 4:39020469-39020491 GGCTGAGTTGGGAGGATCGCTGG - Intronic
972642725 4:40940309-40940331 CGCTGAGTAAGTAGGACAGCAGG - Intronic
972858898 4:43142509-43142531 GGCAGTGGAGGGAGGGCATCAGG + Intergenic
974074500 4:57156416-57156438 GGCTGAGCAGGGAGGTGAGGTGG + Intergenic
975443326 4:74436871-74436893 GGCAGGGCAGGGAGGGTAGCGGG + Intergenic
976563211 4:86525194-86525216 GGCTGAGGTGGGAGGGTGGCTGG + Intronic
976751931 4:88457589-88457611 GGCTGTGAGGGGCGGGCAGCCGG + Intronic
978446479 4:108785512-108785534 GGCTGAGTTGGGAGGATTGCTGG + Intergenic
978978922 4:114917532-114917554 GGCTGAGGTGGGAGGGCTGGAGG + Intronic
979693286 4:123583598-123583620 GGCTGAGGTGGGAGGATAGCTGG - Intergenic
980129293 4:128803530-128803552 GGATGGGTTGGGAGGGCGGCGGG - Intergenic
981730278 4:147889709-147889731 TCCTGTGTTGGGAGGGCAGCTGG + Intronic
982537911 4:156629560-156629582 GGATAAGTAGGGAGTGCACCTGG - Intergenic
983787655 4:171753972-171753994 GGCTGAGGTGGGAGGACTGCCGG + Intergenic
984429155 4:179626141-179626163 GGCTGAGGAGGGACGACTGCTGG - Intergenic
985089441 4:186348424-186348446 GGCTGGGGAGGGGGGGCAGGTGG - Intergenic
985478995 5:95578-95600 GGCTGGGAAGGGAGGGAATCTGG - Intergenic
985521158 5:374423-374445 GGCTGAGCCTGGAGGGCAGGAGG + Intronic
985966956 5:3344868-3344890 CGCTGGTTAGGGAGGGTAGCTGG + Intergenic
987187529 5:15440489-15440511 GGCAAAGAAGGGAGGGCTGCGGG - Intergenic
988347013 5:30050290-30050312 AGCTGAGTAGGAATGACAGCAGG - Intergenic
988435734 5:31173056-31173078 GGCTGAGTCAGGAGGGTAGCTGG - Intergenic
988548174 5:32176658-32176680 GGCTGGGGGTGGAGGGCAGCTGG - Intergenic
989454417 5:41626010-41626032 GGATGAGTGGGGAAGACAGCAGG - Intergenic
989571879 5:42952963-42952985 GGCTGAGGCGGGAGGATAGCTGG - Intergenic
992963319 5:81976974-81976996 GGCTGAGGTGGGAGGATAGCTGG - Intronic
992991980 5:82293007-82293029 GGCTGAGGCAGGAGGGCTGCTGG + Intronic
993047939 5:82889684-82889706 GGCTGAGTTGGGAGGATTGCTGG - Intergenic
994184980 5:96807404-96807426 GGCGGGGTGGGGCGGGCAGCTGG - Intronic
995097316 5:108253577-108253599 GGCTGAGTAGGGGAGTCAGCTGG - Intronic
996339089 5:122416382-122416404 GGCTGAGGAAGGAGGACAGAAGG - Intronic
996805229 5:127447097-127447119 TGCTGAGTAGGCTGGGCAGGAGG + Intronic
996949723 5:129110958-129110980 GGCTGAGCAGGGCAGGCAGCTGG + Intronic
997207216 5:132056969-132056991 GGATGGGCAGGGAGGCCAGCTGG - Intergenic
997517259 5:134499226-134499248 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
997694685 5:135851853-135851875 GGCTGAGGAGGGGGTGCTGCAGG - Intronic
997959885 5:138312267-138312289 GGCTGAGAAGGGAGGACTGCTGG + Intronic
998029982 5:138858225-138858247 GGCTGAGGTGGGAGGACTGCTGG - Intronic
998393282 5:141801647-141801669 GACTGAAGAGGGAGGGCAGAGGG - Intergenic
999775933 5:154813211-154813233 GGAGGAGAAGGGAGGGGAGCAGG + Intronic
1001131974 5:169071842-169071864 GGATGAGTGGGCAGGGCAGAGGG + Intronic
1001288652 5:170441156-170441178 TGCTGGGCTGGGAGGGCAGCTGG - Intronic
1001406999 5:171483569-171483591 GTCTGAGTAGGGAAGGGAGCTGG + Intergenic
1001740064 5:174045761-174045783 GGCTGAGGAGGGAGGACTCCTGG + Exonic
1001962810 5:175890414-175890436 GGCTGATTAGGGCTGGCAGCTGG - Intergenic
1002051440 5:176573878-176573900 GGCTGTGTGGGGAGGGGAGGAGG + Intronic
1002065939 5:176651657-176651679 GGGTGAGAAGGTAAGGCAGCGGG + Exonic
1002112344 5:176926534-176926556 GGCTGAGGTGGGAGGACTGCTGG + Intronic
1002441113 5:179265065-179265087 GGGTGAGTGGGGTGGGCAGCGGG - Intronic
1002521868 5:179796684-179796706 GGCTGAGTAGGGAGTGGGGTAGG - Intergenic
1002576178 5:180175374-180175396 GGATGAGTCTGGAGAGCAGCAGG - Intronic
1002694742 5:181078219-181078241 GGCTGAGGTGAGAGGGCTGCTGG + Intergenic
1002707629 5:181173479-181173501 GGCTGAGGCGGGAGGACGGCTGG - Intergenic
1002898474 6:1392533-1392555 AGGGGAGCAGGGAGGGCAGCTGG - Intronic
1003773641 6:9335745-9335767 GGGAGGGTAGGGAGGGAAGCAGG - Intergenic
1004411927 6:15389258-15389280 GGCTGAGGTGGGAGGGTTGCTGG - Intronic
1004689765 6:17983335-17983357 GGCAAAGTAGGGATGACAGCAGG + Intronic
1005922512 6:30415092-30415114 GGCTCAGCAGGGAGGTGAGCCGG + Intergenic
1006458633 6:34145459-34145481 GGCTGGGAAGGGAGCGGAGCGGG + Intronic
1007077017 6:39074525-39074547 GGCAGATTAGGGAGGACAGAGGG - Intronic
1007081426 6:39107860-39107882 GGCTAAGGAGGGAGGGCATGAGG + Intronic
1007274227 6:40661623-40661645 GGCAGAGGAGGGAGAGGAGCAGG + Intergenic
1007280754 6:40710581-40710603 GGAGTAGTAGGAAGGGCAGCAGG - Intergenic
1007398018 6:41588185-41588207 GGCTGAGGCTGGAGGGGAGCAGG - Intronic
1007475395 6:42116453-42116475 GGCTGAGGTGGAGGGGCAGCAGG - Intronic
1007501698 6:42303421-42303443 AGCAAAGTAGGGAGGGCAGCAGG + Intronic
1007550319 6:42724463-42724485 GGCTGAGGAGTGAGGGAAGGAGG - Intergenic
1007665463 6:43510536-43510558 GGCTGAGTGGGTAGGGCTGACGG + Exonic
1007812942 6:44499109-44499131 GTCTGAGCTGGGAGAGCAGCTGG - Intergenic
1008003831 6:46388807-46388829 GGCAGAGTGGGGAGAGCATCAGG + Intronic
1008137148 6:47789931-47789953 GACTGAATAGGGAGGGCTACAGG + Intronic
1008301014 6:49839348-49839370 GGCTGAGGTGGGAGGATAGCTGG + Intronic
1010274103 6:73949045-73949067 GGCTGAGAAAAGAAGGCAGCAGG + Intergenic
1010810027 6:80290248-80290270 GGCTGGGGTGGGAGGGGAGCAGG + Intronic
1011603552 6:89081256-89081278 GGCCGAGTCTGGAGGGCGGCCGG + Exonic
1012177151 6:96101752-96101774 GGCTGAGATGGGAGGATAGCTGG - Intronic
1012316659 6:97789753-97789775 GGATAGGTAGGGAGGCCAGCAGG - Intergenic
1012768902 6:103404164-103404186 GGGTGAGTGGGAAGGCCAGCAGG - Intergenic
1013532414 6:111032275-111032297 GGCTGAGTTTGGAGGACTGCTGG - Intergenic
1013787399 6:113796979-113797001 GGCTGAGGTAGGAGGTCAGCAGG - Intergenic
1015516856 6:134091076-134091098 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
1015543055 6:134335117-134335139 GGCTGAGGAGAGAGGGTAGCAGG - Intergenic
1016307902 6:142702672-142702694 GAAGGAGTAGGGAGAGCAGCTGG - Intergenic
1017842291 6:158232040-158232062 GGCCGGGGAGGGAGGGCGGCCGG + Intergenic
1018681618 6:166270185-166270207 GGGTGAGCAGGGAGGACAGGAGG + Intergenic
1018914374 6:168123819-168123841 GGCTGATTCGGGAGGTCAGAGGG + Intergenic
1019452104 7:1104297-1104319 GGCTGAGGCGGGAGGGTTGCTGG + Intronic
1019794742 7:3041355-3041377 GGAGGAGTGGGAAGGGCAGCAGG - Intronic
1020161869 7:5779520-5779542 CGCTGAGAAGGGAGAGAAGCGGG - Intronic
1020204909 7:6106663-6106685 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1020244096 7:6417321-6417343 GGCTGAGGTGGGAGGGTCGCTGG + Intronic
1020678032 7:11203355-11203377 GGCTGAGGCTGGAGGACAGCTGG + Intergenic
1021715176 7:23455238-23455260 GGCTGAGCGGAGAGGGCAGCTGG - Intronic
1022417250 7:30188932-30188954 GGAGGAGGAGGGAGGGCTGCTGG + Intergenic
1022528107 7:31051353-31051375 GGCTGGGTGGGGTGGGCAGAGGG + Intergenic
1022728877 7:33004468-33004490 TCCTGAGCAGAGAGGGCAGCCGG - Intronic
1023921780 7:44635528-44635550 GGTGGAGTAGGGAGGGCAGCTGG + Intronic
1024368569 7:48552947-48552969 GGGTGTGTAGGGAGGGAAGTGGG - Intronic
1027239226 7:76316499-76316521 GGCTGAGGTAGGAGGGTAGCTGG - Intergenic
1027277107 7:76568491-76568513 GGCTGAGCATGTGGGGCAGCAGG + Intergenic
1027931794 7:84546527-84546549 AGCTGAATGGGGAGGACAGCAGG + Intergenic
1028450450 7:90976454-90976476 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1029071482 7:97902618-97902640 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
1029160913 7:98551333-98551355 GGCTGAGGCGGGAGGACTGCTGG - Intergenic
1029268790 7:99363773-99363795 GGCTGAGGTGGGAGGGCTGCTGG - Intronic
1029643498 7:101836481-101836503 TGCTGAGCAAGGAGGGCAGGTGG - Intronic
1029696232 7:102215048-102215070 GGCTGAGGAGAGAGGACACCCGG + Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1032254747 7:130288170-130288192 GGCTGAGGCGGGAGGGCTGCTGG - Intronic
1032504340 7:132424359-132424381 GGCTGAGGAGGGAGCTCAGCTGG + Intronic
1032544593 7:132731107-132731129 GCTTGAGTAGGGAGAGGAGCAGG + Intergenic
1032720885 7:134550118-134550140 AGGTGAGTAAGGAGGTCAGCAGG - Intronic
1033405937 7:141072024-141072046 TGCCGAGGAGGGAGGGCAGGTGG + Intergenic
1034124453 7:148658431-148658453 GGGTGAGCATGGAGGACAGCTGG + Intergenic
1034275656 7:149822752-149822774 GGCTGTGAGGGGAGGGGAGCAGG - Intergenic
1034279108 7:149839058-149839080 GGCTGAAAAGAGAGGGCATCTGG + Intronic
1034451341 7:151138725-151138747 GGCTGAGTAGGGAGGTCGGACGG + Intronic
1034516081 7:151580785-151580807 GGCTGGGAAGGGAGGGTAGTGGG + Intronic
1034554046 7:151838604-151838626 GGCTGAGGTGGGAGGACCGCTGG + Intronic
1034568564 7:151935692-151935714 GGCTGAGCAGAGAGACCAGCTGG - Intergenic
1035003257 7:155634169-155634191 GGCTGGGGAGTGAGGGCAGGAGG - Intronic
1035054385 7:156024342-156024364 AGCTGACAAGGGCGGGCAGCTGG - Intergenic
1035100180 7:156389772-156389794 GGATGAGTCTGGAGGGGAGCGGG + Intergenic
1035377689 7:158416217-158416239 GGCTGACTATGGAGTGAAGCTGG - Intronic
1036424228 8:8628494-8628516 GGCTCACCAGGGAGGGCAGAAGG - Intergenic
1036588860 8:10149449-10149471 GCCTGGGCAGGGAGGGCAGCAGG - Intronic
1036888042 8:12574650-12574672 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
1038677425 8:29635916-29635938 GGCAGGGTAGGGAGGTCACCAGG + Intergenic
1039074936 8:33681670-33681692 GGCTGAGCAGGGATTGCGGCCGG - Intergenic
1039613203 8:38935517-38935539 GGCTGAGTTGGCAGGACTGCTGG - Intronic
1039613933 8:38939992-38940014 GGCTGAGTTGGGAGGATCGCTGG + Intronic
1040480655 8:47823233-47823255 GGCTGAGGTGGGAGGACCGCCGG + Intronic
1040655867 8:49506765-49506787 GGCTGAGGCTGGAGGGTAGCTGG - Intergenic
1041552771 8:59119521-59119543 GGCGGGGTAGGGAGCGCGGCCGG + Intergenic
1042490095 8:69387394-69387416 TGGTGGGTAGGGAGAGCAGCAGG + Intergenic
1042543850 8:69933404-69933426 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043180780 8:77083892-77083914 GACTGAGAAGGGTGGGCAGCAGG + Intergenic
1043844977 8:85152988-85153010 GGCTGAGGAGTGCGGGCAGATGG + Intergenic
1044591769 8:93919482-93919504 GGGGGGGGAGGGAGGGCAGCGGG - Intronic
1045873049 8:106947562-106947584 GGCTGAGTTGGGATGCCAACAGG + Intergenic
1046654061 8:116874249-116874271 GGCTGCGGAGGGAGGGGAGGAGG - Intronic
1046776008 8:118164107-118164129 GGAAGAGGAGGGAGAGCAGCAGG + Intergenic
1047290825 8:123528550-123528572 GGCTGTGTAGGGGAGGGAGCAGG + Intronic
1047982556 8:130198045-130198067 GCCTCAGTAGGGAAGGCACCAGG - Intronic
1048209678 8:132444268-132444290 GGCTGGGTGAGGAGGGCAGGAGG - Intronic
1048222264 8:132552759-132552781 GACTGAGGCGGGAGGGCAGAGGG + Intergenic
1048343910 8:133561989-133562011 GGCTGAGGTGGGAGCTCAGCAGG + Intronic
1048575976 8:135690446-135690468 GGCTGAGGAGTGAGGGCACACGG - Intergenic
1048642565 8:136380622-136380644 GACTCAGGAGGGAGGGCAGGAGG + Intergenic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049124244 8:140772326-140772348 GGCTGAGTTGGGAGGACTGCTGG + Intronic
1049222507 8:141434417-141434439 TGCTGGGTAGGGGGGGCAGGAGG + Intergenic
1049273172 8:141706901-141706923 CACTGAGGAGGGAGGGGAGCAGG + Intergenic
1049706043 8:144042923-144042945 GGCTGAGATGGGAGGGCCACTGG - Intronic
1049733838 8:144192827-144192849 GGCTGAGCAGCTGGGGCAGCTGG + Intronic
1050259420 9:3825895-3825917 TGCTGAGGAAGGAGGGCTGCAGG + Intronic
1050410844 9:5363348-5363370 GGCTGAGTGGGGAAGGCCACTGG - Intronic
1050421472 9:5470023-5470045 GGCTGTGTAGTGATGACAGCTGG - Exonic
1051127003 9:13815824-13815846 GGAAGAGAAGTGAGGGCAGCAGG + Intergenic
1051485434 9:17603462-17603484 GGTTGAGAGGGGAGGGCAACTGG + Intronic
1052974816 9:34402614-34402636 GCCTGAGGAGGGAGGGAAGAGGG + Intronic
1054352641 9:64031228-64031250 GGCTGAGGTGGGAGGACAGTTGG - Intergenic
1054972905 9:71109184-71109206 AGCTGATGAGGGAGGCCAGCAGG - Intronic
1056765153 9:89440506-89440528 GGCTGAGTGTGGAGGGCAAGCGG - Intronic
1056768415 9:89459615-89459637 GGCTGAGCAGGGACAGCTGCAGG - Intronic
1057505114 9:95627334-95627356 GGCTGGGGAGGGAGGGGACCAGG - Intergenic
1058597494 9:106630647-106630669 GGCTGGGTAGGGAGAGCTTCTGG + Intergenic
1059363075 9:113762696-113762718 GGCAGAGCAGGGAGGGAACCAGG - Intergenic
1059749252 9:117232429-117232451 GGCTGCTTTTGGAGGGCAGCTGG - Intronic
1060403230 9:123360440-123360462 GGCGGGGTGTGGAGGGCAGCAGG - Intronic
1060936150 9:127517347-127517369 AGCTCAGGAGAGAGGGCAGCAGG - Intronic
1061119179 9:128632764-128632786 GCCTGAGCAGGGAGGGCAGGTGG - Intronic
1061327974 9:129875499-129875521 GGGAGAGCAGGGTGGGCAGCTGG + Intronic
1061404411 9:130385498-130385520 GGCTGAGTGGGGAGGGCGCAGGG + Intronic
1061408631 9:130406217-130406239 GGTTAAGAAGGGAGGGCAGGTGG + Intronic
1061852801 9:133425745-133425767 GGTAGAGCTGGGAGGGCAGCTGG - Intronic
1062018364 9:134303802-134303824 GGCTGAGGACGGAGGTGAGCAGG - Intergenic
1062034302 9:134375998-134376020 TGCGGAGAAGGGAGGCCAGCAGG - Intronic
1062106737 9:134759036-134759058 GGCTGAGAAAGCAGGGCAGGCGG - Intronic
1062321929 9:135994361-135994383 GGCTTGGAAGGGAGGGCAGGCGG + Intergenic
1062351492 9:136141895-136141917 GGCTTAGCAGGGAAGGAAGCTGG - Intergenic
1062597682 9:137306472-137306494 GGTGGAGCAGGGAGGGCAGGGGG - Intergenic
1203524693 Un_GL000213v1:76028-76050 GGCTGAGCAGGGTGGGGGGCAGG + Intergenic
1185514810 X:691548-691570 GGCTGAATCGGGATGGGAGCTGG + Intergenic
1186750212 X:12614055-12614077 GGCTGAGGTGGGAGGGTTGCTGG + Intronic
1187322370 X:18251208-18251230 GGCTGAGGTGGGAGGACTGCTGG + Intronic
1189730843 X:44019103-44019125 ACCTGAGTAGGCAGGGGAGCTGG - Intergenic
1189750647 X:44217707-44217729 GGGGGAGAGGGGAGGGCAGCAGG + Intronic
1190085708 X:47393664-47393686 GGCTGAGACAGGAGGACAGCTGG - Intronic
1190090812 X:47435678-47435700 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1192175274 X:68881191-68881213 GGCTGAGGGGGGTGGGAAGCAGG + Intergenic
1192180711 X:68914068-68914090 GGGTGGGTAGGGAGGTCAGTAGG - Intergenic
1193111119 X:77731809-77731831 GGCTCAGTGGAGAGGGGAGCTGG - Intronic
1193728682 X:85076051-85076073 GGCAGAGAAGAGAGGGAAGCAGG + Intronic
1195072078 X:101291128-101291150 GGCTGGCTGGGGAGGGCTGCGGG + Intronic
1195082708 X:101386291-101386313 GGTGGAATAGGGACGGCAGCAGG - Intronic
1196395830 X:115261058-115261080 GGCTGAGGTGGGAGTGAAGCAGG + Intergenic
1197271198 X:124426517-124426539 GTCTCATTAGGGAGGGCAACTGG + Intronic
1197732438 X:129822460-129822482 GGGTGAGGAGGGAGGGCATTAGG + Intronic
1198311141 X:135426374-135426396 GGCGGGGGAGGGAGGGCAGAGGG + Intergenic
1198328635 X:135600322-135600344 GGAGGAGTAGGGAGAGCATCAGG - Intergenic
1198376071 X:136041380-136041402 GGCAGAGTAGGGGTGGCATCTGG + Intronic
1198385366 X:136124044-136124066 AGCTGAGGTGGGAGTGCAGCAGG + Intergenic
1198484265 X:137070862-137070884 GGCTGAGCAGGGAGGCAGGCAGG - Intergenic
1200226168 X:154419075-154419097 GGCTGGGGAGGGAGGGCAGGTGG + Intronic