ID: 913215741

View in Genome Browser
Species Human (GRCh38)
Location 1:116618853-116618875
Sequence CCTTCTTTGCAGGAGATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 7, 2: 0, 3: 16, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913215741_913215746 -6 Left 913215741 1:116618853-116618875 CCATACATCTCCTGCAAAGAAGG 0: 1
1: 7
2: 0
3: 16
4: 211
Right 913215746 1:116618870-116618892 AGAAGGCTAGAGGCAAGTCAGGG No data
913215741_913215747 13 Left 913215741 1:116618853-116618875 CCATACATCTCCTGCAAAGAAGG 0: 1
1: 7
2: 0
3: 16
4: 211
Right 913215747 1:116618889-116618911 AGGGTACACCAGCATCTTTAAGG 0: 1
1: 3
2: 1
3: 4
4: 95
913215741_913215745 -7 Left 913215741 1:116618853-116618875 CCATACATCTCCTGCAAAGAAGG 0: 1
1: 7
2: 0
3: 16
4: 211
Right 913215745 1:116618869-116618891 AAGAAGGCTAGAGGCAAGTCAGG 0: 1
1: 0
2: 8
3: 13
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913215741 Original CRISPR CCTTCTTTGCAGGAGATGTA TGG (reversed) Intronic
905619251 1:39428035-39428057 CCTGTTCTGCAGGAGATGTCAGG - Exonic
906760472 1:48372722-48372744 CCTAGTTTTCAGAAGATGTATGG - Intronic
907583568 1:55593927-55593949 CCTAATTTGAAGGAGATGGAAGG - Intergenic
908161104 1:61409490-61409512 CCTTATTTGGAGGGGATTTAAGG + Intronic
910055843 1:83032258-83032280 CCTAGTTTTCAGAAGATGTATGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913092905 1:115492004-115492026 ACTTGTTTGGAAGAGATGTAAGG + Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
915512448 1:156393596-156393618 CCTTCATGGAAGGAGATGTCTGG + Intergenic
915602921 1:156933490-156933512 ACTGCTTTGGAGGAGAGGTAAGG + Intergenic
916653045 1:166848694-166848716 CCTTCTTTGCAGATGAAGAAGGG - Intronic
916785822 1:168086457-168086479 CCTACTTTCCAGAAAATGTAAGG - Intronic
918990755 1:191694904-191694926 CCTTGATTTCAGCAGATGTATGG - Intergenic
919021615 1:192113261-192113283 CCCTCTTTGAAGGGGATGTTTGG + Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919290481 1:195623755-195623777 CCTAGTTTTCAGAAGATGTATGG + Intergenic
920727874 1:208453881-208453903 GCTTCTTTGCAGAAGATATTGGG - Intergenic
923897471 1:238288095-238288117 CCTTGTCTGCAGAAGTTGTAAGG - Intergenic
924013450 1:239693103-239693125 ACTGCTTTGAAGGAGAAGTATGG + Intronic
924280145 1:242428980-242429002 CCATCTTTAGAGGAGATGGACGG - Intronic
1063484865 10:6410441-6410463 CCTTCTTGGGAGGAAATGTAGGG + Intergenic
1068770174 10:60811971-60811993 CCTTTTTTGGAGGACATGTCAGG + Intergenic
1069175742 10:65286384-65286406 CCTACATTTCAGAAGATGTATGG - Intergenic
1069855270 10:71436953-71436975 GCTTCTTTGCAGGATATGATAGG + Intronic
1070521300 10:77255938-77255960 CCTTCTTTGCATCAGGTGTTAGG - Intronic
1070745287 10:78930057-78930079 CATCCTTTCCTGGAGATGTAGGG - Intergenic
1071018948 10:81029595-81029617 CCTACATTTCAGAAGATGTATGG - Intergenic
1071951152 10:90703707-90703729 TCTTCTTTGCTGTAGATATAGGG - Intergenic
1073475204 10:103748046-103748068 CCATCCTTGCAGGAGATGGGTGG - Intronic
1076251624 10:128988686-128988708 CCTTCCTGTCAGGAGATGTAAGG + Intergenic
1076498553 10:130915933-130915955 GCTTGTTTGCAGGAGATGAGGGG + Intergenic
1079842191 11:25417385-25417407 CCTTCTTGGCAGAAGAAGCATGG + Intergenic
1079949527 11:26784370-26784392 CCTAGATTTCAGGAGATGTATGG + Intergenic
1080071371 11:28092120-28092142 TCTTATTTTCAGGAAATGTATGG + Intronic
1084034955 11:66504020-66504042 CCTTATTTGTAGGAGAGGAATGG + Intronic
1086137006 11:83451899-83451921 CTTTCTTTGCATGAAATGTTGGG + Intergenic
1087725151 11:101707911-101707933 CCTAGGTTTCAGGAGATGTATGG + Intronic
1088304029 11:108389274-108389296 CCTTCTTTCCAGCACATTTATGG - Intronic
1089092862 11:115892755-115892777 CCCACTTTGCTGGAGATGAATGG + Intergenic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1091409422 12:229400-229422 CTATCTTTGCAGGAGCTGTGTGG - Intronic
1093089413 12:14904642-14904664 CCGTCTTTGCAGAAGATAAAGGG + Intronic
1094713218 12:32986124-32986146 ACTTGTTTGCAGGCGATGCAGGG - Intergenic
1095595700 12:43955485-43955507 GCTTGTCTGCAGTAGATGTATGG - Intronic
1096479591 12:51929832-51929854 CCATCTTTGTAGACGATGTAAGG - Intergenic
1098324142 12:69283184-69283206 CCTTGTTTACAGGTGAGGTAAGG + Intergenic
1100215226 12:92440965-92440987 CCCTGTATGGAGGAGATGTATGG - Intergenic
1101359028 12:104008936-104008958 CCTACATTTCAGAAGATGTATGG + Intronic
1103383843 12:120516095-120516117 CTTTCTTTACAGGAGATGAGAGG + Intronic
1104293118 12:127486936-127486958 ACTTTTTTGCAGGCGTTGTACGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1107374157 13:39784227-39784249 TATTCTTTGCAGGTGATGTCAGG - Intronic
1108266140 13:48710901-48710923 CCTTTTTTTCAGGAAATGAAGGG + Exonic
1108371042 13:49768923-49768945 CCTTATTTGCATGAAATGTAAGG - Intronic
1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG + Intergenic
1109196669 13:59385209-59385231 CCATCTTTGCAGGGGAGGAATGG + Intergenic
1109948011 13:69463375-69463397 ACTTCTGTGCAGAGGATGTATGG + Intergenic
1116127052 14:40801028-40801050 CCTAGATTTCAGGAGATGTATGG - Intergenic
1118069607 14:62231870-62231892 CCTACATTTCAGAAGATGTATGG + Intergenic
1119932470 14:78561592-78561614 CCCTGTTTGAAGGAGATGTGTGG - Intronic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1123005972 14:105324043-105324065 GCTTTTGTGCAGGAGATGGAGGG + Intronic
1123929705 15:25159279-25159301 CATTCTTGGGAGGAGATGTGGGG + Intergenic
1124205260 15:27713098-27713120 CCTTCCTTTCGGGAGATCTAGGG - Intergenic
1126250594 15:46563823-46563845 CATTTTTTGCAGGAGAGGTCTGG + Intergenic
1126873230 15:53011359-53011381 CCTTTATTTCAGAAGATGTATGG - Intergenic
1127301722 15:57661517-57661539 CTTTCTTAGAAGGAGAGGTAAGG + Exonic
1128392769 15:67193999-67194021 TCGTCCTTACAGGAGATGTAGGG + Exonic
1129469457 15:75742718-75742740 CCTAGATTTCAGGAGATGTATGG + Intergenic
1131994907 15:98124425-98124447 GCATCTTTGCATGAGATTTAAGG - Intergenic
1133681556 16:8124792-8124814 CCTTCTTTGCAGAATATATGTGG - Intergenic
1134083563 16:11341060-11341082 GCTATTTTGCAGGAGATTTAAGG + Intronic
1136531513 16:30872864-30872886 ACTTCTTTACAGGAGTTGTCAGG + Intronic
1138805672 16:60086032-60086054 CCTAAATTTCAGGAGATGTATGG - Intergenic
1141039046 16:80655784-80655806 CCTTCTCTCCAGGAGACGCAGGG + Intronic
1144739685 17:17574888-17574910 CCTTCTCTGAGGGAGATGTTGGG - Intronic
1146636003 17:34505207-34505229 ACTTCGTTGAAGGAGATATAAGG + Intergenic
1151769708 17:76152244-76152266 CCTTCTTGGCAGGAACTGCAGGG + Intronic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1152978200 18:245208-245230 CCTTCTTAGCATTAGATTTATGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1154073438 18:11176701-11176723 TGTTTTTTGCAGGAGATGTGGGG - Intergenic
1161185476 19:2916110-2916132 GTTTCTCTGCAGGATATGTACGG + Exonic
1161669701 19:5599325-5599347 CCTTTATTGCTGGAGATGAATGG - Intronic
1164410951 19:28004435-28004457 CCTTGCTTGCAGGAGGTCTAAGG + Intergenic
1165681291 19:37778539-37778561 CTTTCTTTCCAGTAGATGTTGGG - Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1166665170 19:44675408-44675430 TGTGTTTTGCAGGAGATGTAGGG - Intronic
925679625 2:6405648-6405670 CCTTCATTAAAGGAGATATATGG - Intergenic
925720690 2:6823662-6823684 GCTGCTTTGCTGGAGATGTTTGG - Intergenic
925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG + Intergenic
927991733 2:27452922-27452944 GCTTCTTTTCAGGAAATGTTGGG + Intronic
928259947 2:29757457-29757479 CCTTCCTTACAGGACATGAAAGG - Intronic
929158789 2:38811367-38811389 ACTTGTTTGCGGGTGATGTAAGG + Intronic
930006776 2:46904150-46904172 CCTAGTTTTCAGAAGATGTATGG + Exonic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
936788558 2:116124080-116124102 CCTAGATTGCAGAAGATGTATGG + Intergenic
938850026 2:135250750-135250772 CCTGGATTTCAGGAGATGTATGG + Intronic
939016902 2:136913763-136913785 CCTAGATTTCAGGAGATGTATGG + Intronic
940361113 2:152797159-152797181 TCTTCTCTGCAGGGGATGCAGGG + Intergenic
942495291 2:176533819-176533841 CTTTCTTTGCAGGAAATGAAGGG - Intergenic
943313228 2:186353483-186353505 CCTACATTTCAGAAGATGTATGG + Intergenic
944898965 2:204195249-204195271 GCCTCTTTCCAGGAGATGTTGGG + Intergenic
946668989 2:222082174-222082196 ACTTCTTTGCCTGAAATGTAAGG - Intergenic
946741347 2:222805481-222805503 GGTTCCTTTCAGGAGATGTAGGG - Intergenic
946808957 2:223502045-223502067 CCTTTTTTCCAAGAGCTGTAAGG - Intergenic
947008439 2:225538353-225538375 CCTAGTTTTCAGAAGATGTATGG - Intronic
1169933318 20:10857175-10857197 CCTTCTCTTCAGGAGATTGAAGG - Intergenic
1171296860 20:24024731-24024753 CCTTCTTTCCAGGATGTGAAGGG + Intergenic
1172928171 20:38560203-38560225 CCTTCTATGCAGTAGTTTTAGGG - Intronic
1173890785 20:46508355-46508377 TCTTCTTTGCATTACATGTAGGG - Intronic
1174575015 20:51531150-51531172 CCTGCCTGGCAGGAGATGTTTGG - Intronic
1175791125 20:61740545-61740567 CCTGCTTTCCAGGAGAAGAAAGG - Intronic
1177067945 21:16464086-16464108 CCTTGATTTCAGAAGATGTATGG + Intergenic
1177133283 21:17282910-17282932 CCTATATTTCAGGAGATGTATGG + Intergenic
1178677640 21:34644793-34644815 CTTCCTTTGGAGGTGATGTAAGG - Intergenic
1179316415 21:40247905-40247927 CCTAGGTTTCAGGAGATGTATGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181447590 22:22989967-22989989 CCTGCTTTGCAAGAGCAGTATGG - Intergenic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
952112038 3:30135230-30135252 TCTTCTTTGCAAGAAAGGTAAGG + Intergenic
953791477 3:45951102-45951124 TCTTCTTTGCAGGAGACGACTGG + Intronic
954455407 3:50595839-50595861 CGTTGTTTGCAGGAGAGGTCTGG - Intergenic
959894126 3:111587695-111587717 CCTACATTTCAGAAGATGTATGG - Intronic
961500103 3:127326380-127326402 CATTCCTTGCAGCAGATGTCAGG + Intergenic
962589331 3:136872899-136872921 CCTGCATTTCAGAAGATGTATGG + Intronic
962879257 3:139560826-139560848 CCTTCTTTACAGGAGAGGAAAGG - Exonic
962976535 3:140450949-140450971 CCATTTTTGCAAGAGCTGTATGG - Intronic
963016134 3:140825991-140826013 CCTTCTTTACTGGTGAAGTATGG - Intergenic
963671613 3:148258529-148258551 CCTAGATTTCAGGAGATGTATGG + Intergenic
969136579 4:5033982-5034004 ACTGCTGTGCAGGAGATGTGAGG + Intergenic
969260181 4:6028405-6028427 CCATCTCTGCTGGAGGTGTAGGG - Intronic
971134507 4:23853674-23853696 CCTTCTGGGTAGGAGATATAAGG - Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972057849 4:34826713-34826735 CCTGGATTTCAGGAGATGTATGG - Intergenic
974436035 4:61858216-61858238 CAGTCTTTGCAGGCTATGTATGG + Intronic
974981886 4:68967156-68967178 CCTACTTTTCAGAGGATGTACGG - Intergenic
975454654 4:74575900-74575922 CCTTCTTTACTGCAGATGTGTGG - Intergenic
977545054 4:98367312-98367334 CCTACATTGCAGGAAATGTATGG + Intronic
977656123 4:99522740-99522762 CCTTGTTTGCAGGAGGCATAAGG - Intronic
978040095 4:104049571-104049593 CAGTCTGTGAAGGAGATGTATGG - Intergenic
979436722 4:120701986-120702008 CCCTCTCTGCAGGAAATGTTTGG + Intronic
979822044 4:125187493-125187515 CTTTCTTTGCAATAGATCTAGGG - Intergenic
982216788 4:153089276-153089298 ATTTCTTTGCAGGAAGTGTAAGG + Intergenic
982279144 4:153666102-153666124 CCTACATTTCAGAAGATGTATGG + Intergenic
982310007 4:153974809-153974831 CCTTGATTTCAGGGGATGTATGG + Intergenic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986358295 5:6950240-6950262 CCTTCTTTCCTCAAGATGTACGG - Intergenic
989497889 5:42130866-42130888 ATTTCTTTGAAGGAGATGTCAGG + Intergenic
992972129 5:82072090-82072112 ACTTCTTTGCAGTTGATGGATGG + Intronic
993309700 5:86313918-86313940 CCTAGATTTCAGGAGATGTACGG + Intergenic
993354206 5:86885530-86885552 CCTTCTGTGGATGAAATGTATGG + Intergenic
994310583 5:98265801-98265823 CCCTCTTTGTAGGAAATATAAGG + Intergenic
994552790 5:101258763-101258785 CCTACATTTCAGAAGATGTATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997266758 5:132499318-132499340 CCTACTTTCCAGGAGAGGAATGG - Intergenic
1000947199 5:167436888-167436910 CCTACATTTCAGAAGATGTATGG + Intronic
1001181661 5:169526191-169526213 CCTAGTTTTCAGAAGATGTATGG - Intergenic
1001248562 5:170125364-170125386 CATACTTTGCAGGAAATGGAGGG - Intergenic
1001737849 5:174021523-174021545 CTTTCTTTGGTGGAGATGTATGG + Intergenic
1001796180 5:174504218-174504240 CTTTCTTTGCAGGAAATGAAGGG + Intergenic
1003133653 6:3416737-3416759 ACTTCTTTGCAGCAGAAGCAGGG - Intronic
1003432935 6:6056607-6056629 GCTTCTTTGCAGCAGAGGTTGGG + Intergenic
1003632450 6:7800413-7800435 CATTCTGTGAAGGAGATGTGAGG - Intronic
1004173110 6:13314296-13314318 ACTTCTTAGAAGGAGAAGTAGGG + Intronic
1006240407 6:32672956-32672978 CCTAGATTTCAGGAGATGTAGGG + Intergenic
1006894196 6:37456182-37456204 CCCTCTTTGCAGTATGTGTAGGG + Intronic
1007273671 6:40657797-40657819 CCTTCTCTGCATGAGCTGTGGGG + Intergenic
1008327857 6:50206801-50206823 CCTTCTTTGGAAGAGATATTTGG + Intergenic
1008660958 6:53667259-53667281 CTTTCTGTGCTGGAGATCTATGG - Intergenic
1011176990 6:84574640-84574662 CCTTATTTCCTGGAGCTGTATGG + Intergenic
1012380617 6:98615641-98615663 CCTAGATTTCAGGAGATGTATGG - Intergenic
1014715722 6:124862449-124862471 CCTAGATTTCAGGAGATGTATGG - Intergenic
1014730960 6:125030965-125030987 CCTACATTTCAGAAGATGTAGGG - Intronic
1018721578 6:166577125-166577147 CCTAGATTGCAGAAGATGTATGG + Intronic
1019098659 6:169609391-169609413 CCTAGATTTCAGGAGATGTATGG - Intronic
1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG + Intergenic
1021090449 7:16477034-16477056 CCTTCATTGAATGAGTTGTATGG + Intronic
1023314526 7:38921610-38921632 CCTTCTTTGCAAGATTTGGATGG + Intronic
1023579849 7:41670168-41670190 CCTTCACTGCATGAGATGTAAGG - Intergenic
1023650518 7:42364371-42364393 CCTTCATTTCAGAAGATGTAGGG - Intergenic
1024006229 7:45226301-45226323 CCCTTTTTGCAGGAAAGGTAAGG + Intergenic
1030495758 7:110297893-110297915 CCTGCTTTGGGGGAGATGGATGG - Intergenic
1032999616 7:137489479-137489501 GCATCTTTGCAGGAAATGGAAGG + Intronic
1033011530 7:137627563-137627585 CCATCTTTGCAGTGGCTGTAGGG - Intronic
1040714801 8:50237609-50237631 CCTTCTTTGAAGGAGAGTTCAGG - Intronic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1049076308 8:140399128-140399150 CCTAGATTTCAGGAGATGTATGG + Intronic
1050206725 9:3204368-3204390 CCTGCTTTGGAGGAGAAGTGGGG - Intergenic
1050567850 9:6905245-6905267 CCGTCTTGGCAGGAGATTGAGGG + Intronic
1051164698 9:14248867-14248889 CCCTCTTTGCCCGAGAAGTAAGG + Intronic
1051771398 9:20583559-20583581 CCTAGATTGCAGAAGATGTATGG - Intronic
1052778896 9:32760427-32760449 CCTGCTATGCAGGAGATCTGCGG - Intergenic
1052782558 9:32795998-32796020 CCTACATTTCAGGAGATGTATGG - Intergenic
1055679864 9:78704169-78704191 CCTGTATTTCAGGAGATGTATGG + Intergenic
1056750174 9:89344704-89344726 CCTTCTTAGCAGTTGCTGTAGGG + Intronic
1057499980 9:95589298-95589320 CATTCCTTGCAGGATATGTCTGG + Intergenic
1057747900 9:97766392-97766414 CCTTCTGTGCAGGAAAGGCAGGG + Intergenic
1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG + Intronic
1059292923 9:113243566-113243588 CCTTCTTTTTAAGAGATGTGGGG + Intronic
1059467539 9:114478565-114478587 CCCTCCTTGCAGGAGGTGCAGGG + Exonic
1060100538 9:120836777-120836799 ACTTCTTTTCAGAATATGTAAGG - Intronic
1061573944 9:131494689-131494711 CCTTCTCTGCAGGACAAGGAAGG - Intronic
1061996716 9:134189898-134189920 CCTGCTTTGCACCAGATGGAAGG - Intergenic
1062157887 9:135063851-135063873 CCTAGTTTTCAGAAGATGTATGG - Intergenic
1062342736 9:136100944-136100966 CCAGCTCTGCGGGAGATGTAGGG - Intergenic
1186039613 X:5461605-5461627 CCCCATTTTCAGGAGATGTAAGG + Intergenic
1186551689 X:10512641-10512663 CCATCTTTGCAGGTGTTGGAAGG - Intronic
1187604271 X:20866435-20866457 CCCCCATTGCAGGAGATTTATGG + Intergenic
1192536413 X:71932210-71932232 CCTGAGTTGGAGGAGATGTATGG + Intergenic
1193503551 X:82310183-82310205 CCTAGATTTCAGGAGATGTAAGG - Intergenic
1193701777 X:84771616-84771638 CCTTTTTTGCTGAAGATCTAAGG + Intergenic
1193899740 X:87162575-87162597 CTTTTTTTGCAGGAGCTATAAGG + Intergenic
1194625989 X:96227392-96227414 CCTTGATTTCAGAAGATGTATGG - Intergenic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1195146687 X:102025812-102025834 CCTTCTTTGGAGAGGAGGTAAGG - Intergenic
1195927795 X:110043970-110043992 CCTTGTGTGAAGGAAATGTAAGG + Intronic
1195992004 X:110692098-110692120 CATTATTAGCAAGAGATGTAAGG + Intronic
1196507257 X:116462239-116462261 CTTTCCTTACAGGAAATGTAAGG - Intronic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1198582562 X:138082107-138082129 GACTCTTTGCAGGAGGTGTAGGG + Intergenic
1198620463 X:138502930-138502952 CTTTCTTTGCATGATTTGTATGG + Intergenic
1199072760 X:143498013-143498035 CCTTGATTTCAGAAGATGTATGG - Intergenic
1199325495 X:146493682-146493704 CCTTGATTTCAGAAGATGTATGG + Intergenic
1200838346 Y:7754631-7754653 CCTTCTGTCCAGGAGAAGTTTGG - Intergenic
1201334033 Y:12859885-12859907 CCTTCTTTCCTGGATATATAAGG + Exonic
1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202224298 Y:22585515-22585537 CTTTCCTTGCTGGAGATGGAGGG - Intergenic
1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202551952 Y:26059912-26059934 CTTTCCTTGCTGGAGATGGAGGG - Intergenic