ID: 913216953

View in Genome Browser
Species Human (GRCh38)
Location 1:116628663-116628685
Sequence GAGCACTGACACTGCTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 4, 2: 0, 3: 23, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913216953 Original CRISPR GAGCACTGACACTGCTTCTG GGG Intronic