ID: 913218395

View in Genome Browser
Species Human (GRCh38)
Location 1:116639514-116639536
Sequence CAGTCTACACAGAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 4, 2: 2, 3: 27, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913218388_913218395 18 Left 913218388 1:116639473-116639495 CCAACCACCTGCAGATGACAGAA 0: 5
1: 1
2: 2
3: 21
4: 232
Right 913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG 0: 1
1: 4
2: 2
3: 27
4: 248
913218390_913218395 14 Left 913218390 1:116639477-116639499 CCACCTGCAGATGACAGAAGGAA No data
Right 913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG 0: 1
1: 4
2: 2
3: 27
4: 248
913218387_913218395 19 Left 913218387 1:116639472-116639494 CCCAACCACCTGCAGATGACAGA 0: 5
1: 0
2: 0
3: 15
4: 211
Right 913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG 0: 1
1: 4
2: 2
3: 27
4: 248
913218391_913218395 11 Left 913218391 1:116639480-116639502 CCTGCAGATGACAGAAGGAAGCT 0: 5
1: 0
2: 1
3: 16
4: 254
Right 913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG 0: 1
1: 4
2: 2
3: 27
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913218395 Original CRISPR CAGTCTACACAGAGGCAAGA AGG Intronic
900659333 1:3774887-3774909 CAGCCTCCCCAGAGGCCAGAAGG + Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
902555766 1:17245741-17245763 CAGCCTGCACTGAGTCAAGAAGG + Exonic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903829647 1:26166935-26166957 ATGTCTACACAGAGGCATGCAGG + Intergenic
905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG + Intergenic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
911007058 1:93237298-93237320 CAGTCTTCACAGACTCAAGGTGG - Intronic
912000763 1:104831969-104831991 GAGGCTGCACAGAGCCAAGATGG + Intergenic
912396174 1:109345756-109345778 CAGCCATCACAGAGGCAAAAAGG + Exonic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
913955467 1:143286561-143286583 CAGTCAAGAAAGAAGCAAGAGGG - Intergenic
913981964 1:143528884-143528906 CAGTCAAGAAAGAAGCAAGAGGG + Intergenic
914076331 1:144355545-144355567 CAGTCAAGAAAGAAGCAAGAGGG + Intergenic
914102847 1:144610952-144610974 CAGTCAAGAAAGAAGCAAGAGGG - Intergenic
914381140 1:147117544-147117566 CAGCCTAGACAGAGGTATGAGGG + Intergenic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
917667653 1:177240895-177240917 CAGTCTGCAGACAGTCAAGAAGG + Intronic
918374321 1:183893659-183893681 GAGTCTACACTGAGACATGAAGG - Intronic
918912549 1:190592313-190592335 AAGTCTCCACAGAGGTAAGGAGG - Intergenic
919307488 1:195861160-195861182 CAGCATACACAAAGGCAAGGTGG - Intergenic
920436879 1:205952785-205952807 CAGTCTCCACATATGCAAAATGG - Intergenic
920988252 1:210910999-210911021 CAATCTACACAAATGCAAGTAGG - Intronic
923642210 1:235775667-235775689 AAGGCTACACAGAGAGAAGATGG + Intronic
923784741 1:237055876-237055898 AGGTCCACACAGAGGGAAGATGG + Intronic
1063993009 10:11586759-11586781 AAGTATAAATAGAGGCAAGAGGG + Intronic
1065313351 10:24437541-24437563 CAGTGTAGACAGAGCCAAAAGGG + Intronic
1066593932 10:37027757-37027779 CTCGCTACACACAGGCAAGATGG - Intergenic
1067472009 10:46544282-46544304 CAATCTCCACAAGGGCAAGAAGG + Intergenic
1068353497 10:55880893-55880915 CAGCCTGCACAGAGCCAAGAAGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069725305 10:70573724-70573746 CAGGCTACGTAGAGGCAAGAGGG - Intergenic
1070560562 10:77563603-77563625 CAGTCTCCATAGAGGAAAAAGGG + Intronic
1073317300 10:102592178-102592200 AAGTCCACAGAGAGGCAACAGGG - Intronic
1074500167 10:114016634-114016656 CAGTCTGCCCAGAGGTAAAATGG - Intergenic
1075232366 10:120691339-120691361 CAGTCTGCAAAGGGGCAGGAAGG - Intergenic
1075456909 10:122590773-122590795 CAGTATCCACACAGGTAAGAAGG - Intronic
1075786307 10:125052511-125052533 CAGACAACACAAAGGCAGGACGG - Intronic
1076259745 10:129055886-129055908 CAGTGAACACAGCGGCAGGAGGG + Intergenic
1077035990 11:494775-494797 CAGGCTGCACACAGGCCAGAAGG + Exonic
1077242090 11:1515901-1515923 CAGCCTTCACAGAGGCACGAGGG + Intergenic
1078098882 11:8317527-8317549 CAGTCTAGTCCCAGGCAAGAAGG + Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1081574792 11:44312146-44312168 CAGTCTACCCATATGCAAAATGG - Intergenic
1081742279 11:45449032-45449054 CAGTCTACACAGAGATACAAAGG + Intergenic
1081818538 11:45968218-45968240 TTCTCTGCACAGAGGCAAGAAGG + Intronic
1083342142 11:61965574-61965596 CGATCTACAGGGAGGCAAGATGG + Intronic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1085370242 11:75996601-75996623 CAGTTTATACAGAGGCATGGAGG + Intronic
1087974516 11:104528416-104528438 AAGTTTTCACAGAGGTAAGAGGG - Intergenic
1088692051 11:112336610-112336632 CAGTGTGCACAGAGGCAAAGGGG + Intergenic
1091001575 11:131914110-131914132 CTGTGTACAGAGAGGCAAGTAGG + Intronic
1091362960 11:134992741-134992763 CTGTCTACATAGAGACCAGAGGG + Intergenic
1092943163 12:13429190-13429212 CAGTCTGCACAGTCCCAAGAGGG + Intergenic
1094097824 12:26727886-26727908 CATTCAGCACAGGGGCAAGAGGG + Intronic
1094217195 12:27955660-27955682 CAATTTACACAAAGGCAAGTTGG - Intergenic
1094835179 12:34318902-34318924 GACTCTCCAAAGAGGCAAGAGGG - Intergenic
1095576484 12:43745973-43745995 TTCTCTACACTGAGGCAAGAGGG - Intronic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1098184680 12:67883615-67883637 GAGCCCCCACAGAGGCAAGAGGG - Intergenic
1100256184 12:92885709-92885731 CAGCCTACTCAGAGACAACAAGG - Intronic
1100596642 12:96077909-96077931 AAGTCTTAACAGAGGCAAGTGGG - Intergenic
1102741444 12:115211088-115211110 CAATAGACACAGAGCCAAGAAGG + Intergenic
1103017346 12:117505782-117505804 CAGCATAGACAGAAGCAAGAAGG - Intronic
1103122168 12:118389372-118389394 CAGTCTCCACAGTGGCAGGATGG - Intronic
1103873853 12:124112042-124112064 CAGTTTAGACAGAGGGGAGAAGG - Intronic
1104468719 12:129011109-129011131 CAGTCTACATGGTGGCAGGAGGG + Intergenic
1105209596 13:18249992-18250014 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1108610291 13:52078724-52078746 CAGTCTTCACAGGGCCAAGAGGG + Intronic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110456076 13:75691815-75691837 CAGTCTTCACTGAGTAAAGAGGG - Intronic
1110653728 13:77972602-77972624 CAGTCTAAAGAGAGTCAAGAGGG + Intergenic
1112759877 13:102682639-102682661 CAGTATACACAGCAGCAACAGGG - Intergenic
1113356945 13:109589943-109589965 TAAACCACACAGAGGCAAGATGG + Intergenic
1113736264 13:112680692-112680714 CAGTTTACAGACAGGCAAGCAGG + Intronic
1118250154 14:64151900-64151922 CACTCTACTCAGAGGAAGGACGG - Intronic
1118589116 14:67387835-67387857 CAGTTTCCACAGACACAAGATGG + Intronic
1118827215 14:69394869-69394891 CAGCCTACCAAGAGGCCAGAAGG - Exonic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121291215 14:92777140-92777162 CCTTCTGCCCAGAGGCAAGAAGG - Intergenic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1123772425 15:23541626-23541648 CATTCTCCAGGGAGGCAAGAGGG - Intergenic
1124621583 15:31277031-31277053 CAGAGTCCACAGAGGCAAGCTGG - Intergenic
1124674644 15:31673863-31673885 CAGCCTTCACAGAGAGAAGAAGG - Intronic
1125614045 15:40993924-40993946 CACTCTAAACAGAAGCTAGAAGG + Intronic
1129139264 15:73582405-73582427 CAGTCAAGACAGAAGCAAGAAGG + Intronic
1132720123 16:1311639-1311661 CAGGCCACAGAGAGGCCAGACGG - Intronic
1133205677 16:4232083-4232105 CTGTCTACACAGAGGCAGAGCGG - Intronic
1136701313 16:32146234-32146256 CAGTCGAGAAAGAAGCAAGAGGG + Intergenic
1136766349 16:32781230-32781252 CAGTCGAGAAAGAAGCAAGAGGG - Intergenic
1136801749 16:33089148-33089170 CAGTCGAGAAAGAAGCAAGAGGG + Intergenic
1137913622 16:52404636-52404658 CAGGCTTCTCAGAGGCAAGTGGG - Intergenic
1138465175 16:57185240-57185262 CAGTCCACACAGAGGAAAGGGGG - Intronic
1139302568 16:65958023-65958045 CAGGCTTCAAAGAGGAAAGATGG + Intergenic
1141090538 16:81127465-81127487 CAGTCCACCCTTAGGCAAGAGGG - Intergenic
1141361173 16:83396453-83396475 CAGGCAACAGAGAGGAAAGAGGG - Intronic
1141482747 16:84317885-84317907 CAGACTGCAGAGTGGCAAGAAGG - Intronic
1203068737 16_KI270728v1_random:1043476-1043498 CAGTCGAGAAAGAAGCAAGAGGG - Intergenic
1146558671 17:33849389-33849411 CAGTCTCCACAGTTGCAACATGG - Intronic
1147695658 17:42350662-42350684 CCGTCTTCACAGTAGCAAGAGGG - Intronic
1147836134 17:43333216-43333238 CAGCCTCCTCAGAGGAAAGAGGG + Intergenic
1148137748 17:45305897-45305919 CAGTGGACACAGAAGCCAGATGG - Intronic
1152095711 17:78270464-78270486 CTGTCTTCTAAGAGGCAAGATGG + Intergenic
1153658265 18:7304554-7304576 CACCCCACACAGAGGCATGAGGG - Intergenic
1154488873 18:14903601-14903623 CTGTCTACATAGAGACCAGAGGG - Intergenic
1155299963 18:24420027-24420049 CATTCCACTCAGAGGCAAAAGGG + Intergenic
1156475058 18:37400687-37400709 CAGTATTCACAAAGGCAAGCTGG + Intronic
1156570717 18:38249891-38249913 CAGTATACAGAGAGGCAGGGAGG + Intergenic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157158605 18:45291561-45291583 CAGTGTCCTCAGAGGCAAGAGGG + Intronic
1157487498 18:48098880-48098902 CTGTTTACAAAGTGGCAAGATGG - Intronic
1159574143 18:70155650-70155672 CAGTCTGCACAGAGCCCAGAGGG + Intronic
1165991754 19:39819270-39819292 TAGTCTGCACAGAGGAAGGAGGG - Intergenic
1167312174 19:48743362-48743384 CAGTCTAGAGAGAGCCTAGATGG - Intronic
1168180391 19:54658733-54658755 CAGTCCACACAGCAGCCAGAAGG - Intronic
925204709 2:1996251-1996273 CAGTCCACACTGAGGCAGGGCGG - Intronic
925204722 2:1996320-1996342 CAGCCCACACTGAGGCAAGACGG - Intronic
925204733 2:1996389-1996411 CAGTCCACACTGAGGCAAGACGG - Intronic
926151663 2:10428978-10429000 CTTGCTACAAAGAGGCAAGACGG + Intergenic
926989433 2:18661671-18661693 GAGGCTACAAAGGGGCAAGAGGG + Intergenic
927115236 2:19893475-19893497 CACTCTACAGAAAGGAAAGAAGG - Intergenic
927517847 2:23682464-23682486 AAATCCACACAGAGGCAGGATGG - Intronic
929084656 2:38156481-38156503 CAGTCTGCACAGAGACATGGGGG + Intergenic
930513714 2:52380041-52380063 CAGTCTACACAAAGGAGAGCTGG - Intergenic
930990710 2:57650672-57650694 CAGTGTAGACAGAGGCAATGGGG + Intergenic
932508711 2:72263442-72263464 TAGTCTACACAGTGGCAGGAGGG - Intronic
935389174 2:102532433-102532455 GAGCCTACACAGAGGAAGGAAGG + Exonic
937081958 2:119146671-119146693 CTTTCTACTGAGAGGCAAGAAGG + Intergenic
937426374 2:121802606-121802628 AAGTGAACACAGAGGCCAGAAGG + Intergenic
937628974 2:124077667-124077689 CAGCCTAAACACAGGCATGATGG - Intronic
937815072 2:126242410-126242432 CAGACTACAAAGAGGAAAGTTGG - Intergenic
937842933 2:126543902-126543924 CAATCTAAACAAAGGCAAAAAGG + Intergenic
939124839 2:138165342-138165364 CACTCTACACACAGGCAAATCGG + Intergenic
940132886 2:150404312-150404334 CAGCCGAAAGAGAGGCAAGAAGG + Intergenic
941236099 2:162976258-162976280 AAGTCTACACTGACTCAAGATGG + Intergenic
941498759 2:166241884-166241906 CAGTCAACTAAGAGTCAAGAAGG + Intronic
941706511 2:168664241-168664263 TAGTCTCCTCAGAGGCAAGCAGG + Intronic
941707082 2:168670552-168670574 CCATCCACACAGAGGAAAGAAGG - Intronic
942607412 2:177707545-177707567 CAGTCTACAAAGAGGAGAGAAGG - Intronic
942701048 2:178710872-178710894 CAGCATCCACAGGGGCAAGACGG + Exonic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944314112 2:198267130-198267152 CAGTCTCCCCAGAGGCTTGAAGG + Intronic
947319369 2:228898873-228898895 GAGGCAACACAGAGGAAAGAAGG - Intronic
948149696 2:235735382-235735404 CAGTCTACACAGAGACAAGTCGG - Intronic
948343936 2:237279481-237279503 CAGTTTATAGAGAGGCTAGAAGG + Intergenic
948594928 2:239073790-239073812 CAGTCTAGTCAGTGGCAGGATGG + Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169564019 20:6833052-6833074 CAGGCTACAGTGAGCCAAGATGG + Intergenic
1169698476 20:8418896-8418918 CTGCCTACACAGAGGGGAGAGGG + Intronic
1171274548 20:23845011-23845033 CAGTCTATACATAGGAAAGGTGG - Intergenic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173289917 20:41705561-41705583 CAGTCTACTCAGTGTGAAGATGG + Intergenic
1173945017 20:46943601-46943623 CATGCTACACACAGGCAAGCTGG - Intronic
1176062053 20:63176739-63176761 CAGTCTAAACAAAGGCCAGCGGG + Intergenic
1176948823 21:15018978-15019000 CAAACTACACATAGGGAAGAGGG - Intronic
1177057059 21:16319232-16319254 CAGTAGACACTGAGGCCAGAGGG + Intergenic
1180766668 22:18349407-18349429 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1180779645 22:18512971-18512993 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1180812361 22:18770292-18770314 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1180819696 22:18817594-18817616 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181198520 22:21204539-21204561 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181205921 22:21252039-21252061 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181401218 22:22651261-22651283 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1181648312 22:24245630-24245652 CAGTCTGCACAGAGGACAGGGGG + Intergenic
1181703183 22:24632341-24632363 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1182651373 22:31853981-31854003 CAGCCTACACAGAAGCAGGAAGG - Intronic
1182869346 22:33632589-33632611 GAGGCAACACAGAGGCAGGAAGG - Intronic
1183698484 22:39436710-39436732 CAGTGGACACAGATGCATGAGGG - Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
1203221000 22_KI270731v1_random:43374-43396 CGGTCTACACAGAGGCAAGAAGG - Intergenic
1203228285 22_KI270731v1_random:90298-90320 CAGTCTGCACAGAGGACAGGGGG - Intergenic
1203269825 22_KI270734v1_random:43447-43469 CGGTCTACACAGAGGCAAGAAGG + Intergenic
949689218 3:6615381-6615403 GTGTCTACTCAGAGGCAAGCTGG - Intergenic
950461520 3:13125004-13125026 CAGTCCACACAGCAGCCAGAGGG + Intergenic
951350076 3:21596190-21596212 CAGTTTTCACAGCGGCAAGGAGG + Intronic
952579932 3:34821512-34821534 CAGAAAACACAGAGGCCAGATGG - Intergenic
952828908 3:37546738-37546760 CAGTCCAGACAGAGGCAAGCAGG - Intronic
952928912 3:38344651-38344673 CAGTCTAGTCACAGGCAAGAAGG + Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954223932 3:49171079-49171101 CAGTGTACACTGAGGCTAGCGGG - Intergenic
956479458 3:69659503-69659525 CATTCCGCACAGAGGCAACATGG - Intergenic
957021089 3:75127142-75127164 AGGTCTACACAGAATCAAGATGG - Intergenic
957996502 3:87696650-87696672 CAGCCTACACAGTGTCAACAGGG + Intergenic
965500080 3:169445815-169445837 CAGGTTACACTGATGCAAGAGGG - Intronic
967752059 3:193126349-193126371 CAGTCCATACGGCGGCAAGAAGG - Intergenic
970644647 4:18106513-18106535 CAGTCCACACAGACAGAAGATGG - Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
974342992 4:60638227-60638249 GAGTCTGCACAGAGCCCAGAGGG - Intergenic
977247596 4:94651609-94651631 CAGTCTAACCAGAGGCAAGTGGG - Intronic
978667930 4:111208956-111208978 CAATCCACACAGTGGCATGAAGG + Intergenic
982839860 4:160170524-160170546 CAGTCTGCTCAGAGGAATGAGGG - Intergenic
983840473 4:172451572-172451594 CAGCTTATACAGATGCAAGATGG + Intronic
985144705 4:186884111-186884133 CTGTCTACACATATGCAAAATGG - Intergenic
985371788 4:189292704-189292726 CAGGCCACACTGATGCAAGAGGG - Intergenic
987759088 5:22135917-22135939 CAGTGAAAACAGAGTCAAGAGGG - Intronic
988213815 5:28245205-28245227 CAGTGTATACAGAGGTAATAGGG - Intergenic
988261531 5:28892525-28892547 AAGTGTACACAAAGGCAAAAGGG + Intergenic
988786139 5:34567075-34567097 TGGTCTACACAGTGGTAAGATGG + Intergenic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
990336169 5:54774860-54774882 CAGTTTGCACAGCGGCAAAAGGG + Intergenic
990413204 5:55561564-55561586 CAGTGTGCACTCAGGCAAGAAGG - Intergenic
991893800 5:71369363-71369385 CAGTGAAAACAGAGTCAAGAGGG - Intergenic
992005508 5:72473563-72473585 CAGTCTAAACAAAGGCAACGAGG - Intronic
992179665 5:74183888-74183910 GAAACTGCACAGAGGCAAGAGGG + Intergenic
993034634 5:82743652-82743674 AAGTCTACCCATATGCAAGAAGG + Intergenic
993732770 5:91442097-91442119 AAGCCTACAGAGAGGAAAGATGG - Intergenic
995448213 5:112270328-112270350 CAACCTACACAGAGGTAATAAGG + Intronic
995530846 5:113090640-113090662 CAGTCTACCCAGAAGGACGATGG + Intronic
995811850 5:116115530-116115552 CAGTCAACACAGATTCAAGAGGG - Intronic
997340906 5:133143858-133143880 CAGTCTACAGAGAGGTAGGGAGG - Intergenic
998382193 5:141733712-141733734 CAGATTACACAAAGGCAAGGGGG + Intergenic
998893982 5:146778460-146778482 CAGCCTACTCAGAGGCAATTTGG + Intronic
999262126 5:150244766-150244788 CAGCCCACACATAGGCAGGACGG + Intronic
999432125 5:151533453-151533475 CAGTCAACACAAAGGCAGGGTGG - Intronic
1000186119 5:158859690-158859712 CAGTATGCACAGAGGCTTGAAGG - Intronic
1001542687 5:172550476-172550498 CCCTCCCCACAGAGGCAAGATGG - Intergenic
1001822135 5:174718739-174718761 CAGACTACACGTAGGGAAGATGG - Intergenic
1002777320 6:340329-340351 CAGTCCACCCAGAGGTAAGTGGG - Intronic
1002944632 6:1749644-1749666 TACACTACACAGTGGCAAGAAGG - Intronic
1004147000 6:13077276-13077298 CAGTTTCCACAAATGCAAGATGG - Intronic
1008052141 6:46911118-46911140 CTCTCTACAGAGAGGCAAGATGG + Intronic
1008428559 6:51387967-51387989 CAGTCTACACATTGGCCAGTCGG + Intergenic
1008663114 6:53689685-53689707 TAGTCTACACAGAGGATATATGG + Intergenic
1009032779 6:58080833-58080855 CAGTCTGCACAGAGCCTGGAGGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1010750359 6:79610729-79610751 CAGCCTGCCCTGAGGCAAGAGGG - Intergenic
1013069516 6:106715984-106716006 CAGTCTCCTCATATGCAAGAAGG - Intergenic
1013786902 6:113791633-113791655 CAGGCTGCAGTGAGGCAAGATGG + Intergenic
1014275650 6:119385261-119385283 TGGTCTACACAGAGGTATGAAGG + Intergenic
1014330380 6:120056246-120056268 CAGTCTACCCAAAGGCTAGTTGG + Intergenic
1016243457 6:141957535-141957557 TAGCCTATACAGAGGCCAGATGG - Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1018335367 6:162781422-162781444 GTGTCTACACAGAGGAAAGAAGG + Intronic
1018602916 6:165564344-165564366 AAGCCTACACAAATGCAAGAGGG + Intronic
1020985801 7:15132929-15132951 AAGTCTTCAGAAAGGCAAGAGGG + Intergenic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1021958369 7:25849496-25849518 CAGTCTGAAGAAAGGCAAGACGG - Intergenic
1022456508 7:30563036-30563058 CATTCTAACCAGAGTCAAGAGGG - Intergenic
1023856640 7:44188252-44188274 CATTTCACACAGAGGCGAGAGGG + Intronic
1026116970 7:67503792-67503814 GAGTCTACACATGGGAAAGAAGG - Intergenic
1026298811 7:69079344-69079366 CAGTCTACCCGGAGGGCAGAAGG - Intergenic
1026449544 7:70515484-70515506 CAATCCTCACCGAGGCAAGATGG - Intronic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1031200555 7:118679152-118679174 ATTTCTACACAGAGGCAAGTTGG - Intergenic
1033222069 7:139534265-139534287 CAGACTACCAAGAGGCCAGAAGG + Intronic
1035362712 7:158324158-158324180 CAGTCTCCGCATAGACAAGACGG + Intronic
1038187771 8:25291259-25291281 CAGTTTCCACAGTTGCAAGAGGG + Intronic
1038831091 8:31061733-31061755 CAGTCTACAAAGACTCCAGAAGG - Intronic
1040779147 8:51086395-51086417 CAGTGTTCACAGAGGCTAGTGGG - Intergenic
1041437709 8:57860812-57860834 CATTCTCCAGAGATGCAAGAGGG - Intergenic
1043674694 8:82936779-82936801 CAGTCTATATAGAGTCCAGAGGG + Intergenic
1046718605 8:117594378-117594400 CTGTCTACACAGTGCCTAGAAGG + Intergenic
1047219933 8:122911098-122911120 CGGTCTACACACACGCAGGATGG + Intronic
1048414904 8:134216242-134216264 CACTCTGCATAGAGGCAAAATGG - Intergenic
1050176567 9:2875340-2875362 CAGTCATCACAGAAGCAAGGAGG - Intergenic
1051931084 9:22386974-22386996 CAGTCTTCACCGTGGCAAAATGG - Intergenic
1052551556 9:29956811-29956833 CACTCCACACAGAAGTAAGAAGG + Intergenic
1053057188 9:35000265-35000287 GTGTCTACACAGAGGCCAAAGGG - Intergenic
1055472634 9:76628531-76628553 CACTCTGCACAGACACAAGACGG - Intronic
1055532104 9:77194526-77194548 CAGTCTGCACGGAGCCCAGAAGG - Intronic
1055878860 9:80974609-80974631 CAGTCTAGTCCCAGGCAAGAAGG - Intergenic
1058905603 9:109480236-109480258 CAGGTTACACTGAGCCAAGATGG - Intronic
1059393653 9:114017160-114017182 CAGTCTGAACAGATGCATGAAGG + Intronic
1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG + Intronic
1062176602 9:135166694-135166716 CAGTCCACCCAGCGGCAAGAAGG + Intergenic
1187285343 X:17898827-17898849 CAATCACCACAGAGTCAAGAAGG - Intergenic
1195350104 X:103987481-103987503 CAGTCTACACTGAGCCGAGATGG - Intergenic
1195351817 X:104003631-104003653 CAGTCTACACTGAGCCGAGATGG + Intergenic
1195357340 X:104051358-104051380 CAGTCTACACTGAGCCGAGATGG + Intergenic
1196473819 X:116059202-116059224 CAGCCTATACAGAGCCCAGAGGG - Intergenic
1196493218 X:116292481-116292503 CCTTCTACAAAGAGACAAGATGG + Intergenic
1196718144 X:118828973-118828995 CAGTCTCTCCAGAGCCAAGAGGG + Intergenic
1197766939 X:130065500-130065522 CAGTCATCACAGAGGCAGGCTGG + Exonic
1198925949 X:141795657-141795679 CAGTCTTGATGGAGGCAAGAGGG + Intergenic
1201539042 Y:15086042-15086064 TAGTCTACAAAAAGGCAAAAAGG - Intergenic