ID: 913222070

View in Genome Browser
Species Human (GRCh38)
Location 1:116667665-116667687
Sequence CCATCCAGGCGCACGCCTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 53}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913222061_913222070 12 Left 913222061 1:116667630-116667652 CCTCTCCCTCCGCGCGCGTCGGA 0: 1
1: 0
2: 0
3: 9
4: 70
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53
913222062_913222070 7 Left 913222062 1:116667635-116667657 CCCTCCGCGCGCGTCGGACCGTC 0: 1
1: 0
2: 0
3: 0
4: 15
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53
913222064_913222070 3 Left 913222064 1:116667639-116667661 CCGCGCGCGTCGGACCGTCCTTC 0: 1
1: 0
2: 0
3: 0
4: 11
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53
913222058_913222070 18 Left 913222058 1:116667624-116667646 CCTGGCCCTCTCCCTCCGCGCGC 0: 1
1: 0
2: 2
3: 53
4: 509
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53
913222054_913222070 30 Left 913222054 1:116667612-116667634 CCTGACCTCGCCCCTGGCCCTCT 0: 1
1: 0
2: 0
3: 44
4: 476
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53
913222056_913222070 20 Left 913222056 1:116667622-116667644 CCCCTGGCCCTCTCCCTCCGCGC 0: 1
1: 0
2: 5
3: 54
4: 523
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53
913222059_913222070 13 Left 913222059 1:116667629-116667651 CCCTCTCCCTCCGCGCGCGTCGG 0: 1
1: 0
2: 1
3: 5
4: 89
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53
913222055_913222070 25 Left 913222055 1:116667617-116667639 CCTCGCCCCTGGCCCTCTCCCTC 0: 1
1: 0
2: 18
3: 206
4: 2124
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53
913222063_913222070 6 Left 913222063 1:116667636-116667658 CCTCCGCGCGCGTCGGACCGTCC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53
913222057_913222070 19 Left 913222057 1:116667623-116667645 CCCTGGCCCTCTCCCTCCGCGCG 0: 1
1: 0
2: 3
3: 27
4: 285
Right 913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG 0: 1
1: 0
2: 1
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913222070 Original CRISPR CCATCCAGGCGCACGCCTCA GGG Exonic
905629518 1:39510937-39510959 CCAGCCAGGTGCAGGGCTCAGGG + Intronic
912381416 1:109249933-109249955 CCATCCAGACGCAGGCCCCGCGG + Intergenic
913222070 1:116667665-116667687 CCATCCAGGCGCACGCCTCAGGG + Exonic
921774262 1:219078935-219078957 CTATCCATGCACAGGCCTCAGGG - Intergenic
924784619 1:247183775-247183797 CCATCTAGGCGGACACCACAGGG + Intergenic
1066436138 10:35398040-35398062 CCATCCATGCCCACTCCACATGG - Intronic
1067562761 10:47315300-47315322 CCATCCAGGCACAGGCCTGGAGG - Intergenic
1067681739 10:48445925-48445947 CCACCCAGGGGCATACCTCAGGG + Intergenic
1076233437 10:128842414-128842436 CCATGCCTGCGCACACCTCACGG + Intergenic
1081759376 11:45566516-45566538 CCAGCCTGGCTCAGGCCTCAGGG + Intergenic
1083656853 11:64234179-64234201 CCATCCAGGTGAGCCCCTCAGGG - Exonic
1084592902 11:70100657-70100679 CCAGCATGGCACACGCCTCAGGG + Intronic
1092171050 12:6374322-6374344 CCTTCCAGGCGCAGGCACCAGGG + Intronic
1104516374 12:129430950-129430972 GCTTCCAGGCGCATGCCTGATGG + Intronic
1115776402 14:36720067-36720089 CCAGCCAGGCCCACCCCACATGG + Intronic
1116803590 14:49468676-49468698 CCAGCCAAGCACACACCTCATGG + Intergenic
1119735066 14:76976436-76976458 CCTTCCAGCTGCACACCTCAAGG + Intergenic
1122861391 14:104584195-104584217 CCAGCCAGGTTCACTCCTCATGG - Intronic
1122888126 14:104719559-104719581 GCATCCAGCCGCCAGCCTCAGGG - Exonic
1124651843 15:31479733-31479755 CCCCCCAGGTGCACACCTCAGGG - Exonic
1128349905 15:66881735-66881757 CCAGCCAGGGGCAAGGCTCAGGG - Intergenic
1129221233 15:74132814-74132836 CCACGCAGGCGCACGGCTCCGGG - Exonic
1138657726 16:58500629-58500651 CCATCCAAGCGCACACCAGAGGG - Intronic
1143755490 17:9064274-9064296 ACATCCAGGAGCTCGCCCCAGGG + Intronic
1144022783 17:11251874-11251896 CCAACCTGCCACACGCCTCAAGG + Intronic
1144058340 17:11560310-11560332 CCTTCCAGCCGCACGACTCCAGG - Exonic
1152271602 17:79328207-79328229 CAATCCAGCCTCACGCCTCCTGG - Intronic
1161007906 19:1945446-1945468 CCACCCAGGAGCACGCCTGAGGG - Intronic
1167100453 19:47401550-47401572 CCATCCAGGCCCACCCCAAAGGG + Intergenic
1167337619 19:48896394-48896416 CCCTCCAGGCGAACGCCCCCAGG + Intronic
926197872 2:10774576-10774598 CCCTCCAGGCTAAGGCCTCAGGG - Intronic
927102702 2:19800179-19800201 CCATCCAGCAGCATGCCTCCAGG + Intergenic
927645179 2:24872919-24872941 CCACCCAGGGGCATGGCTCAAGG + Intronic
935331174 2:101979048-101979070 CCATCCAGGTTAACCCCTCAGGG - Intergenic
949041518 2:241852018-241852040 CCACCTAGGAGCACGGCTCAGGG - Intronic
1178959314 21:37049953-37049975 CAATCCAAGGTCACGCCTCAAGG + Intergenic
1180196178 21:46195695-46195717 CCATACAGGCGAAGGCCTCCAGG + Exonic
1182054146 22:27336575-27336597 CCATCCAGGCTTACCCCGCACGG - Intergenic
1184606989 22:45579881-45579903 CCATCCCGGCACACGGCTCCTGG + Intronic
1185218823 22:49618612-49618634 CCATCCTGGAGCACGGCTCACGG + Intronic
951812362 3:26714841-26714863 TCAGCCAGGGGCACTCCTCAAGG + Intergenic
954317286 3:49807986-49808008 ACCTCCAGGCCCAAGCCTCAAGG + Intronic
984866416 4:184284188-184284210 CCATCCAGGTGCCCGCCACCAGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
987119455 5:14753071-14753093 CCATCCAGGGCCACTCCTCTGGG - Intronic
998218112 5:140252871-140252893 CCATCCAGGCTGGCGGCTCAGGG - Intronic
1001279249 5:170374594-170374616 CCATCCAGGTGCACCTCTCCAGG + Intronic
1004323978 6:14656802-14656824 CCATCCAGCCGCACCCCTCAGGG + Intergenic
1026436223 7:70401282-70401304 CCATCCTGGCACACATCTCAGGG - Intronic
1027247964 7:76380001-76380023 CCATCGCGCCGCACTCCTCAGGG - Intergenic
1035530834 8:349799-349821 CCATCCAGCCTCAGGCATCAGGG - Intergenic
1051061412 9:13049332-13049354 CCATCCAGCCACAGGCCGCAGGG + Intergenic
1060298962 9:122362835-122362857 CCATCCAGGCCCAGGACCCAGGG + Intergenic
1060545895 9:124458749-124458771 CCATCCTGGCGCACGTGTCCTGG + Intronic
1062325392 9:136010292-136010314 CCATCCATGCACACCCCTCAAGG + Exonic
1187823004 X:23308331-23308353 CCATCCAGCCACACTCCTCTGGG - Intergenic
1194956744 X:100189891-100189913 TCATCCAGGCCCAGCCCTCAAGG + Intergenic
1199721225 X:150543914-150543936 CCATCCCTGCCCACGCCTCCAGG - Intergenic