ID: 913222080

View in Genome Browser
Species Human (GRCh38)
Location 1:116667720-116667742
Sequence AGGGGCCGCAGCGCGGCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913222080_913222090 9 Left 913222080 1:116667720-116667742 CCAGCAGCCGCGCTGCGGCCCCT 0: 1
1: 0
2: 1
3: 40
4: 291
Right 913222090 1:116667752-116667774 CCGCCCCTCCAGCTCCAGCCCGG 0: 1
1: 0
2: 4
3: 90
4: 768
913222080_913222096 23 Left 913222080 1:116667720-116667742 CCAGCAGCCGCGCTGCGGCCCCT 0: 1
1: 0
2: 1
3: 40
4: 291
Right 913222096 1:116667766-116667788 CCAGCCCGGCCCGCCGCACTCGG 0: 1
1: 1
2: 0
3: 17
4: 199
913222080_913222099 28 Left 913222080 1:116667720-116667742 CCAGCAGCCGCGCTGCGGCCCCT 0: 1
1: 0
2: 1
3: 40
4: 291
Right 913222099 1:116667771-116667793 CCGGCCCGCCGCACTCGGCGAGG 0: 1
1: 1
2: 0
3: 14
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913222080 Original CRISPR AGGGGCCGCAGCGCGGCTGC TGG (reversed) Exonic
900156541 1:1205517-1205539 GGGGGCCTCAGCCCAGCTGCTGG - Intronic
900237660 1:1600264-1600286 GGGGGACGCAGCGAGGCGGCCGG + Intergenic
901217354 1:7562178-7562200 AGGGGCCGGAGCTGGGGTGCCGG - Intronic
901316756 1:8314984-8315006 AGCGGCCGCAGCCCGGCTGGGGG - Intergenic
902465235 1:16613386-16613408 AGGCGCGGCGGCGCGGCTGCCGG - Exonic
902910954 1:19596990-19597012 AGGGGTCGGAGCGCGGGGGCCGG + Exonic
903155568 1:21440277-21440299 AGGCGCGGCGGCGCGGCTGCGGG + Intronic
903788245 1:25875410-25875432 ACGGGGCGCGGCGGGGCTGCGGG - Intergenic
903813132 1:26045915-26045937 CGGGGCGGCTGCGCGGCTGCCGG - Exonic
904278054 1:29397007-29397029 ACGGGCAGCAGCGGGGCAGCTGG + Intergenic
904688135 1:32275142-32275164 AAGGGCCGCAGGAGGGCTGCGGG - Intronic
905960089 1:42035903-42035925 AGGAGCCGTGGCGCGGCGGCGGG + Intronic
908951416 1:69567514-69567536 GCGGGGCGGAGCGCGGCTGCCGG - Intergenic
910963394 1:92784885-92784907 AGACGCGGCGGCGCGGCTGCCGG - Intronic
913089469 1:115466630-115466652 AGGGGCCGCAGAGCTCCAGCAGG - Intergenic
913222080 1:116667720-116667742 AGGGGCCGCAGCGCGGCTGCTGG - Exonic
914242028 1:145858788-145858810 AGGGGCTGCGGCGGGGCTCCGGG - Intronic
915288892 1:154869801-154869823 AGGGGCTGCTGGGGGGCTGCTGG + Exonic
917788799 1:178486747-178486769 AGAGGCCGCAGCAGGGCTGGAGG + Intergenic
919760328 1:201094085-201094107 AGGGAACCCAGCACGGCTGCAGG - Intronic
920504508 1:206506959-206506981 ACGGGACAAAGCGCGGCTGCGGG + Intergenic
920917190 1:210267268-210267290 AGGGGCTGCAGCCCGGTTCCAGG + Intergenic
922315059 1:224434626-224434648 GGGCGCCGCGGGGCGGCTGCGGG + Intronic
922766397 1:228158683-228158705 GGGGGCCGCGGCGCGGGGGCGGG - Exonic
923698891 1:236281720-236281742 AGCGGCCGCGGTGCAGCTGCTGG - Exonic
1063392024 10:5656092-5656114 AGAGGCCGCAGAGCTGCAGCCGG + Intronic
1067227893 10:44387078-44387100 TGGGGCCTCAGGGCGCCTGCGGG - Intergenic
1069598268 10:69686743-69686765 AGAGGCTGCAGCTGGGCTGCAGG - Intronic
1071838579 10:89445023-89445045 TGAGGCGGCAGCCCGGCTGCGGG + Intronic
1072169926 10:92848905-92848927 CGGGGCCGCAGCGCGGGGCCCGG - Intronic
1072508101 10:96090306-96090328 AGCGGCTGCAGCTGGGCTGCTGG + Intergenic
1073290057 10:102409099-102409121 GGGGGCCGCGGCGCGCCGGCCGG - Intronic
1074818528 10:117162985-117163007 AAGGGACCCAGCTCGGCTGCGGG - Intergenic
1075144706 10:119872995-119873017 AGGGCACGCAGCGCCGCTGGAGG + Intronic
1075690218 10:124389284-124389306 ACGGTCCCCAGCGCGGCTCCTGG + Intergenic
1075871534 10:125774962-125774984 AGCGGCCTCCACGCGGCTGCGGG + Intronic
1075961242 10:126569021-126569043 AGGGGCAGCAGCCCGGGGGCAGG + Intronic
1076898148 10:133324475-133324497 CGGGGCTGCAGAGCCGCTGCTGG + Intronic
1076898176 10:133324574-133324596 CGGGGCTGCAGAGCTGCTGCTGG + Intronic
1076898185 10:133324607-133324629 CGGGGCTGCAGAGCTGCTGCTGG + Intronic
1076898194 10:133324640-133324662 CGGGGCTGCAGAGCTGCTGCTGG + Intronic
1077063422 11:627307-627329 AGGGGCGCCAGCGCGGCGGAGGG - Intergenic
1077098541 11:810375-810397 TGGGGCCCCACGGCGGCTGCGGG - Intronic
1077107899 11:849831-849853 GGGGGCCGCAGCGCGCGGGCCGG + Intronic
1077178155 11:1199892-1199914 AGGAGCTGCAGCCCTGCTGCTGG - Intronic
1078514375 11:12009417-12009439 AGGGGCCGCAGCCCGGCCATTGG + Intronic
1081620579 11:44616957-44616979 AGAGGAGGCAGCCCGGCTGCTGG + Intronic
1083572546 11:63768332-63768354 TGGGCGCGGAGCGCGGCTGCAGG - Intronic
1083630319 11:64091854-64091876 AGGAGCACCAGAGCGGCTGCTGG + Intronic
1083746452 11:64739667-64739689 AGGGCCCGCTGCGGGGCTGTGGG + Exonic
1083758046 11:64801911-64801933 AGGGGCCCCAGCCCTGTTGCCGG - Intronic
1084310447 11:68313215-68313237 CGGGGCGGCCGCGCGGCCGCTGG - Intronic
1084438171 11:69156063-69156085 AGGGGCTCCAGGGTGGCTGCGGG + Intergenic
1084566912 11:69935043-69935065 AGAGGTCGGAGCGCTGCTGCTGG + Intergenic
1084575678 11:69986452-69986474 AGGGGCCCCTGCGCGGCCCCTGG + Intergenic
1088579204 11:111299569-111299591 AGGGGCCGCCCCGGGGCTGGCGG - Exonic
1089422794 11:118344235-118344257 AGGGGCCTCAGCAGGGCTGCAGG - Intergenic
1089605532 11:119639103-119639125 AGGGCCCACAGTGCTGCTGCTGG - Intronic
1090663134 11:128895752-128895774 AGGGCGCGCAGCACGGATGCTGG - Intronic
1091232857 11:133999725-133999747 AGGGGCCACTGCCCGGCTGTAGG - Intergenic
1092743244 12:11649892-11649914 ACGGGCCCGAGCGCGGCGGCGGG - Exonic
1095349192 12:41188895-41188917 GGGGGCCGCCGGGCGGCCGCTGG + Exonic
1095476178 12:42589502-42589524 CGGCGCCGCTGCGGGGCTGCTGG + Exonic
1095949361 12:47773464-47773486 CGGGGCGGGTGCGCGGCTGCGGG + Intronic
1096157045 12:49346618-49346640 CGGGGCCGCAGCGCGCCCCCAGG - Intergenic
1096489985 12:52007869-52007891 AGGGGTCGCAGGGCGCCCGCGGG + Intronic
1096495492 12:52037249-52037271 AGCGGCTGCGGCGCGGCTGCAGG + Intronic
1097232788 12:57522632-57522654 AGGGGCTGCAGTGCGCATGCGGG - Intronic
1098477350 12:70920710-70920732 AGTAGCCGCGGCGCTGCTGCTGG - Exonic
1100190531 12:92186363-92186385 AGGAGCTGCACCGCAGCTGCTGG - Intergenic
1101037173 12:100717271-100717293 GGGACCCGGAGCGCGGCTGCCGG + Intergenic
1101761155 12:107660160-107660182 AGGAGCCACAGCACAGCTGCTGG - Intergenic
1102678102 12:114672146-114672168 AGGGGCTGTAGCGCAGCCGCGGG + Exonic
1102853980 12:116277585-116277607 AGGGGACGTCGCTCGGCTGCCGG - Intergenic
1103474809 12:121210433-121210455 CGGGGCCCCGGCGCGGCGGCTGG - Intronic
1104993053 12:132637125-132637147 AGGGGCCACAGTGGGTCTGCAGG + Intronic
1106208768 13:27621830-27621852 AGGAGCCGCAGCGGCGCGGCAGG - Exonic
1106308281 13:28532452-28532474 AGCGGCCGCAGCGCGGCGCCAGG + Intergenic
1108727829 13:53201274-53201296 AGAGGGCGCAGCGCATCTGCCGG - Intergenic
1112356107 13:98675994-98676016 TGGGGCTGCAGCGAGACTGCAGG - Intergenic
1112580666 13:100674474-100674496 AGGGGCCCGAGCGCGGCGGGCGG + Intronic
1113092239 13:106628080-106628102 AGAGGCAGCAGCACAGCTGCAGG + Intergenic
1113811247 13:113143911-113143933 AGGGGCCTCCCCGCTGCTGCTGG - Exonic
1113889078 13:113726574-113726596 ACTGGCCGCTGCGTGGCTGCAGG + Intronic
1113954077 13:114087554-114087576 CGGGGCTGCAGAGCGGGTGCAGG - Intronic
1118312616 14:64704768-64704790 TGGGGCCCCAGCGTGACTGCCGG - Intronic
1118762060 14:68885977-68885999 AGGGGCCCCTGCAGGGCTGCCGG - Intronic
1118777018 14:68979446-68979468 ATGCGCCGCAGCCCGGCTGACGG - Intergenic
1118809217 14:69261213-69261235 GGGGGCGGCGGCGGGGCTGCGGG + Intronic
1119539291 14:75428198-75428220 CGGGGCCGGGGCCCGGCTGCAGG - Intronic
1119732814 14:76961857-76961879 TGGGGCCGCAGCGGGGCTTCCGG - Intergenic
1120765552 14:88324030-88324052 AGCGGCCCCAGTCCGGCTGCAGG - Intronic
1122657919 14:103274182-103274204 CGGGGCTGCTGCGGGGCTGCTGG - Intergenic
1123016408 14:105377666-105377688 GGAGGCCGCTGCGTGGCTGCAGG - Intronic
1123030600 14:105449462-105449484 GGGGGCGGCAGCGCCGCTGAGGG + Intronic
1127224851 15:56918502-56918524 AGGAGCCGCACCGCGGCGGGTGG - Intronic
1127995590 15:64151760-64151782 TGGGGCCGGGGCGCGGATGCTGG + Exonic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1129262118 15:74374338-74374360 GGGGGCCGCAGCTGGGATGCTGG + Intergenic
1129412997 15:75360096-75360118 AGGTGCTGCAGCTGGGCTGCTGG + Exonic
1129716205 15:77852581-77852603 TGTGGCAGCAGAGCGGCTGCTGG + Intergenic
1129725962 15:77901826-77901848 AGGGGCTGCAGCCCGGCTCTGGG + Intergenic
1132527850 16:426273-426295 GCGGGCCGGAGCGCGGCGGCGGG - Exonic
1132566927 16:627811-627833 AGGGGGCGCGGCTGGGCTGCTGG + Exonic
1132597411 16:759618-759640 AGGAGCCGCAGGTTGGCTGCGGG - Intronic
1132778910 16:1612454-1612476 GCGGGCCGGCGCGCGGCTGCGGG - Intronic
1132937372 16:2488000-2488022 AGGGGCCCCAGCGGGGCAGCTGG - Intronic
1132953498 16:2578334-2578356 AGGGGCTGCAGGGCCGGTGCGGG + Intronic
1132960854 16:2621833-2621855 AGGGGCTGCAGGGCCGGTGCGGG - Intergenic
1132972599 16:2696204-2696226 ACGGGCAGCGGCGCAGCTGCCGG + Intronic
1132974030 16:2702704-2702726 AGGGGCCCCAGGCCTGCTGCAGG + Intronic
1134039264 16:11055485-11055507 AGGGGCAGGAGCGCAGCTACAGG + Intronic
1134086754 16:11362552-11362574 AGGGGCCGCCGCCCGTGTGCTGG - Intronic
1135382731 16:22008123-22008145 GCGGGCCGCGCCGCGGCTGCTGG + Intronic
1135598536 16:23761806-23761828 AGGGGCTGCAGTCTGGCTGCTGG + Intergenic
1136272194 16:29154928-29154950 AGGGGCCGCAGGGGGGCAGCTGG + Intergenic
1137988486 16:53130532-53130554 GGCGGCCGCGGCGGGGCTGCCGG + Intronic
1139433130 16:66921817-66921839 AGCAGCCGCAGCGCAGCCGCCGG - Exonic
1139512604 16:67436109-67436131 AGGGGCCGCATCGTGACTGTGGG + Exonic
1139597802 16:67968400-67968422 AGGGGCCGTGGCGGGGCAGCGGG - Intronic
1139601917 16:67992469-67992491 AGGTGCCACAGCATGGCTGCTGG - Intronic
1141137016 16:81473091-81473113 AGGGGCCGCAGGCAGGCTGGTGG - Intronic
1141797800 16:86286636-86286658 AGGGGCCGCAGGGGCGCTGCGGG + Intergenic
1142075771 16:88116832-88116854 AGGGGCCGCAGGGGGGCAGCTGG + Intronic
1142290634 16:89192359-89192381 GGGGGCCGCAGCGCTGCTGGCGG + Exonic
1144021172 17:11241083-11241105 AGGACCCGAAGCGCGGCTCCGGG - Intergenic
1144493026 17:15731204-15731226 AGGCGCAGCACCGAGGCTGCAGG - Intergenic
1144776753 17:17788678-17788700 AGTGGCCTCAGAGCTGCTGCTGG + Intronic
1144907229 17:18645449-18645471 AGGCGCAGCACCGAGGCTGCAGG + Intronic
1145379013 17:22376887-22376909 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145379491 17:22379257-22379279 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145379970 17:22381627-22381649 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145380450 17:22384002-22384024 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145380928 17:22386349-22386371 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145381408 17:22388724-22388746 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145382141 17:22392498-22392520 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145382616 17:22394863-22394885 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145382896 17:22396226-22396248 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145383469 17:22399049-22399071 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145383983 17:22401517-22401539 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145384421 17:22403719-22403741 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1145384740 17:22405181-22405203 ACGGGCGGCTGCGCGGCGGCAGG - Intergenic
1148206802 17:45784468-45784490 AGGGACCGGCGGGCGGCTGCGGG - Intronic
1148271789 17:46267159-46267181 CGGGGCGGCGGCGCGGCGGCCGG - Intergenic
1149923226 17:60678053-60678075 AGGGGCCGGAGGGCGGCCGGGGG + Intronic
1149994445 17:61399485-61399507 TGGGGCCGGCGTGCGGCTGCGGG + Intergenic
1150764596 17:67993395-67993417 CGGGGCGGCGGCGCGGCGGCCGG + Intronic
1151498860 17:74476012-74476034 AGGTGCCGCAGGGAGGGTGCAGG - Intronic
1151805255 17:76400941-76400963 AGGGGCAGCAGCTCAGCTCCAGG + Intronic
1151975553 17:77481922-77481944 TGGGGAGGCAGCGTGGCTGCAGG + Intronic
1152072578 17:78141129-78141151 AGGGGCCCCAGGGAGGCTTCGGG - Exonic
1152280086 17:79380056-79380078 AGGGGCTGCAGTGGGGCTGTGGG - Intronic
1152296327 17:79469327-79469349 AGGGGCCCCAGTGCTGCTGCAGG - Intronic
1152636758 17:81433348-81433370 AGGGGCCGCTGCAAGGCTGTAGG + Intronic
1152801842 17:82334268-82334290 AGGGGCCGCAGGACGCCTGAAGG - Intergenic
1152912456 17:83013189-83013211 AGTGGCCCCAGCGTGGCTGCAGG - Intronic
1152928544 17:83098873-83098895 AGGGGCCAGAGTCCGGCTGCAGG + Intergenic
1152980027 18:268037-268059 AGGCGCCGCAGCGCAGTGGCGGG - Intronic
1153515140 18:5895364-5895386 AGGGCCGGCGGCGCGGCCGCAGG - Exonic
1157222657 18:45838711-45838733 ACGATCCGCGGCGCGGCTGCAGG - Exonic
1159961484 18:74558874-74558896 AGGGGCCTCTGCTGGGCTGCAGG - Intronic
1160207383 18:76846054-76846076 AGGAGCCCCAGCTAGGCTGCAGG - Intronic
1160686824 19:440753-440775 TGGGACCCCAGCGCGGCTGTCGG + Intronic
1160775387 19:852946-852968 AGTGGCCTCCGCGCAGCTGCAGG - Exonic
1160864205 19:1249973-1249995 AGGGGGCGCCGCTCGGCTGGTGG - Exonic
1161077068 19:2290971-2290993 TGGTGCCGCAGCGCGGCGGCCGG + Exonic
1161495002 19:4581689-4581711 GGGGGGCGCTGCGCGGCGGCCGG + Intergenic
1162022349 19:7873638-7873660 AGGGGCCGCCGCGCGGACGCCGG - Exonic
1162379467 19:10323084-10323106 AGGGGCTGCAGCGCTGCCCCCGG - Intronic
1163513075 19:17747710-17747732 CGCGGCTGCGGCGCGGCTGCCGG - Exonic
1164484155 19:28640468-28640490 AGGGGCATCACCGAGGCTGCTGG + Intergenic
1166047581 19:40238512-40238534 AGGGGAAGCTGAGCGGCTGCGGG + Intronic
1166126337 19:40717273-40717295 AGGGGCCCCGGCGGGGCGGCCGG + Exonic
1166330528 19:42075817-42075839 AGGCGGCGGAGCGCGGCCGCGGG - Intronic
1167161261 19:47768757-47768779 TGGAGCTGCAGCGTGGCTGCTGG + Intergenic
1167376456 19:49114665-49114687 CGGGGCCGCAGGGCCGCTGGTGG + Intronic
1168293036 19:55366210-55366232 AGGGGGTGCAGCGGGGGTGCAGG + Intronic
1168536846 19:57177944-57177966 AATGGCCTCAGCGCAGCTGCTGG + Intergenic
925036578 2:692038-692060 TGGGGCCCCGGCGCGGGTGCAGG - Intergenic
925564445 2:5235216-5235238 AGGGGCCTCAGAGCAGATGCAGG + Intergenic
925929087 2:8693449-8693471 AGCAGCCGCAGCGGGGCGGCGGG + Intergenic
926045895 2:9709459-9709481 AAGGGCAGCAGCAGGGCTGCTGG - Intergenic
926202672 2:10812810-10812832 AGGGGCGGCCGCGCGGGGGCGGG + Intronic
926423123 2:12717748-12717770 AGGGGGTGCAGCGCGGATTCTGG + Exonic
928158114 2:28894896-28894918 CTGGGCGCCAGCGCGGCTGCAGG + Exonic
929604394 2:43225526-43225548 AGCTGCGGCAGCGCGGCGGCCGG - Exonic
931021311 2:58047275-58047297 AGGGGCCGCGGCGGGGTTGGAGG + Intronic
932472795 2:71973610-71973632 TGGTCCCGCAGCGTGGCTGCAGG - Intergenic
934650735 2:96089959-96089981 AGGGGCTGCAGCGTGGCAGGTGG + Intergenic
936161028 2:110084442-110084464 AGGTGGCGCAGCGCGGTTCCTGG + Exonic
936183635 2:110286912-110286934 AGGTGGCGCAGCGCGGTTCCTGG - Intergenic
936713637 2:115161506-115161528 AGAGGCCGGAGCGCGGCGCCCGG + Intronic
937119492 2:119431874-119431896 CGAGGCTGCAGCGCGGCCGCCGG + Exonic
937216328 2:120315859-120315881 AAGGGCCACAGTGCTGCTGCGGG - Intergenic
937319300 2:120951424-120951446 AGGGGCCTCAGCCCCGCTGATGG + Exonic
937395345 2:121530143-121530165 AGGGGAGGCAGGGTGGCTGCCGG + Intronic
938406323 2:131035103-131035125 CGGGGCCGCGCCGGGGCTGCGGG - Intronic
938971980 2:136441120-136441142 AGGGGCCTCAGTAGGGCTGCAGG - Intergenic
939734549 2:145827671-145827693 AGGGGCTGCAGCAGGGCAGCAGG - Intergenic
942073670 2:172337417-172337439 AGGGGCGGGAGTGAGGCTGCAGG + Intergenic
944007328 2:194925788-194925810 AGAGGCCGCTGCACGGCTCCTGG + Intergenic
946019899 2:216633760-216633782 AGCAGCCGCAGCCCGGCTCCCGG - Exonic
946418681 2:219552937-219552959 AGGGGCCGCAGCGTCGCAGCTGG + Exonic
948860108 2:240748668-240748690 AAGGGCCCCAGCCCTGCTGCTGG - Intronic
1169171731 20:3470970-3470992 AGGGGCCACAGCGGGGCGGTGGG - Intergenic
1169206878 20:3745591-3745613 TGGGGCCGCAGCGCACCTGAAGG - Exonic
1170208508 20:13824592-13824614 AGGGCCTGCAGCGCAGCTGACGG + Intergenic
1170890078 20:20368838-20368860 GGGGGCCGCAGGGCGGCGGCAGG - Exonic
1170890146 20:20369038-20369060 GGGGGGCGCGGCGCGGCCGCTGG + Exonic
1173856040 20:46251389-46251411 GGTGGCCTCAGCGCGGCCGCCGG + Exonic
1174656388 20:52175847-52175869 GGGGGCGGCAGCGGGGGTGCGGG - Intronic
1175668009 20:60876895-60876917 AGTGGCAGCAGCGGGGATGCTGG - Intergenic
1175922723 20:62457571-62457593 AGGGGACATGGCGCGGCTGCAGG + Intergenic
1175999846 20:62826894-62826916 AGGGGCCCCAGTGGGGCTGGGGG - Intronic
1176039572 20:63058087-63058109 AGGGGCTGCTGAGCTGCTGCAGG - Intergenic
1176411671 21:6452484-6452506 AGGGGCCGCAGCCCCACTGCAGG - Intergenic
1179687165 21:43060806-43060828 AGGGGCCGCAGCCCCACTGCAGG - Intronic
1180744414 22:18077980-18078002 CCGGGACGCCGCGCGGCTGCGGG + Exonic
1181941748 22:26483421-26483443 AGGGGCCTCAGTGGGGCAGCAGG + Intronic
1182076349 22:27498064-27498086 AGGGGCCACTGCGCAGCTTCAGG - Intergenic
1182236941 22:28883598-28883620 AAGGGCCGCGGCGCGACGGCCGG + Exonic
1183370131 22:37427497-37427519 AGGGGCAGAGGCGCGGCGGCGGG - Intergenic
1183383671 22:37503053-37503075 AGGGGCCACGGCGGGGCTTCAGG + Intronic
1184210979 22:43035439-43035461 AGGGGCTGCAGGGCTGCTGCGGG + Intergenic
1185131956 22:49044332-49044354 AGGGGCAGCAAGGCTGCTGCTGG + Intergenic
950148430 3:10668024-10668046 AGTGGCCACAGGGTGGCTGCTGG + Intronic
950683898 3:14602984-14603006 CCGGGCCGCAGGGCGGCCGCGGG - Intergenic
953385037 3:42501653-42501675 AGGGGCGGCTGCTCGGCCGCTGG - Intronic
954028710 3:47803110-47803132 AGGGGCCGCGCCGCCGCTGCTGG + Exonic
954437455 3:50503569-50503591 ACGGGCCGCAGCGCCTCTGCGGG + Intronic
954912500 3:54121753-54121775 GGGGGCCGCTGCGCTGCGGCCGG + Intergenic
959565952 3:107833472-107833494 AGGGAACCTAGCGCGGCTGCAGG + Intergenic
961021979 3:123515519-123515541 AGGGGCTGCAGTGCTGGTGCTGG + Intronic
961473966 3:127135667-127135689 AGGGGCCGCGGGGAGGGTGCGGG - Intergenic
962808893 3:138945765-138945787 CGGGGCCGCCGCGCCGCCGCCGG - Exonic
963253306 3:143120880-143120902 AGGGCACGCGGCGCGGCTGCAGG - Exonic
963293470 3:143518255-143518277 AGGGGCTGCAGCCCGGTTCCAGG + Intronic
963514687 3:146293614-146293636 AGGGGCGGCAGCGAGGCTGGGGG - Intergenic
964720684 3:159764956-159764978 AGTGGCCGCGGCCCGGCGGCTGG + Exonic
964743219 3:159988711-159988733 AGGGGGCGCTGCACAGCTGCGGG + Intergenic
967137929 3:186528279-186528301 AGGGGCTGCAGCGCCGCTGGAGG - Intergenic
967511937 3:190322496-190322518 AGGGGGCGCTCCCCGGCTGCCGG - Intergenic
968225600 3:196970071-196970093 AGGGGCCCCGGCGAGGCCGCAGG + Intergenic
968556396 4:1248362-1248384 AGGGGACGGGGCGCGGGTGCCGG - Intronic
968599887 4:1503821-1503843 AGGGGCTGCTGCGCTTCTGCAGG + Intergenic
968958493 4:3730731-3730753 AGGGGGCGCAGGGCAGGTGCTGG + Intergenic
969240388 4:5893139-5893161 CGGGGCCTCTGGGCGGCTGCGGG + Intergenic
969540851 4:7787978-7788000 AGGGGCCGCTGTGGGGCTGCGGG - Intronic
979547170 4:121951567-121951589 CGGAGCCGCAGCGCCGCCGCCGG - Exonic
983495940 4:168442427-168442449 AGGGGCGGCAGCGAGGCTGGGGG + Intronic
983879074 4:172912644-172912666 AGAGGCCGCAGCGAGGGTGGGGG + Intronic
985611745 5:893069-893091 AGGTGCATCAGCGCGGCAGCAGG + Exonic
985689132 5:1297433-1297455 AGGGGCAGCTGGGAGGCTGCAGG - Intergenic
990840820 5:60077522-60077544 AGGGGCCCCAGCCTGGCTGCAGG - Intronic
992052801 5:72956352-72956374 GGGGCCCGCAGCGGGGCCGCCGG + Intronic
995787173 5:115842190-115842212 AAGGGCCGCAGCGCGCCGGAGGG - Intronic
997652842 5:135535177-135535199 AGGGGACGCACTGCGGCGGCAGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998583485 5:143403750-143403772 AGGGGCCGCGCGGCGGCCGCGGG + Intronic
998844667 5:146296342-146296364 AGGGCCCGCAGAGCTGATGCAGG + Intronic
1002055831 5:176597476-176597498 AGAGGCCGCAGCGCCCCCGCCGG - Exonic
1002419630 5:179138873-179138895 AGAGGCCGGAGCGCAGCAGCCGG + Intronic
1003872166 6:10412230-10412252 GGGGGCCGCGGCGCGGCGTCTGG + Intronic
1005859325 6:29888748-29888770 AGGGGCCACAGGGCGCCTCCCGG + Intergenic
1006413590 6:33890300-33890322 AGGGGCAGCAGCGCTGTTGGCGG - Intergenic
1006814324 6:36840050-36840072 AGGGGCCGGGGCGGGGCCGCGGG + Intergenic
1010043984 6:71420120-71420142 CGGGGCCGCAGCGCGGCCGGTGG - Intergenic
1010703274 6:79077651-79077673 AGAGGCGGCCGCGCGGCGGCGGG + Intronic
1015503107 6:133953375-133953397 CGCGGCGGCAGCGCTGCTGCCGG - Exonic
1016713985 6:147203699-147203721 AGGTACCGCAGCCCGGCTCCTGG + Intergenic
1017898973 6:158704412-158704434 AGGAGCCGCAGCGGGGACGCGGG + Intronic
1018309615 6:162494272-162494294 AGGGGACACAGCACAGCTGCAGG - Intronic
1019732299 7:2634833-2634855 TGGGGCCGCAGCCCTGCTGTAGG + Intronic
1019998502 7:4740908-4740930 AGTGGCCGCAGCGGGGAGGCTGG - Exonic
1020085716 7:5309104-5309126 GGGGGCCGCAGCCGGGCCGCAGG + Intronic
1020136950 7:5592900-5592922 AGAGGCCGCTGCGCGGCCCCGGG - Exonic
1020261104 7:6531236-6531258 AGGGGCCAGGGCGGGGCTGCGGG - Intronic
1021162967 7:17298814-17298836 AGGTGCCGCCGCGCTGCTCCCGG - Exonic
1021868185 7:24979582-24979604 AGGGGCCGCGGCGCAGGTGCGGG - Intronic
1022113828 7:27246425-27246447 AGGGGCCGCCGGCTGGCTGCCGG + Exonic
1025078760 7:55964737-55964759 AGGGGCCGCCGCGAGGCGGAGGG + Intronic
1025208586 7:57008045-57008067 GGGGGCCGCAGCCGGGCTGCAGG - Intergenic
1025663361 7:63568833-63568855 GGGGGCCGCAGCCGGGCTGCAGG + Intergenic
1028479252 7:91286665-91286687 AGGGGCAGCAGAGGGGCTGCAGG + Intergenic
1032020767 7:128406146-128406168 CGGGGTCGCAGCGCCGCTGCAGG - Intronic
1032187991 7:129744091-129744113 AAGCGCCGCAGCGGGGCTGGTGG + Intronic
1033654317 7:143362663-143362685 TGGGGCGGCGGCGCGGCTCCCGG - Exonic
1034450951 7:151137084-151137106 AGGGGCCACAGCTCTGCTGCTGG - Intronic
1034560623 7:151877327-151877349 TGGGGCCGCGGCGCGGCGGGGGG - Intergenic
1034659857 7:152759762-152759784 AGCCGCCGCAGCGCCGCTGCCGG - Exonic
1036664608 8:10730515-10730537 AGGGGCCGGGTCGCGGCTGCGGG - Intronic
1037755188 8:21705849-21705871 AGGGGCCGCAGCCCAGCTCAGGG - Intronic
1037947797 8:22999968-22999990 CGGCGCCGCCGCGCTGCTGCTGG - Intronic
1038963496 8:32548072-32548094 GGGGGTGGCGGCGCGGCTGCCGG - Intronic
1040319791 8:46286743-46286765 ACGGGTGGCAGCGGGGCTGCAGG - Intergenic
1041076510 8:54174821-54174843 TGCGGGCGCAGCGGGGCTGCGGG - Intergenic
1043436541 8:80240791-80240813 CGGGGCCGCAGGGCGGCGCCTGG - Intergenic
1048981027 8:139703475-139703497 AGCGGCCGGAGGGCGGCCGCGGG + Intergenic
1049105337 8:140609069-140609091 AGGGGCCTCAGCGGGGGAGCAGG + Intronic
1049171839 8:141166374-141166396 AGGGGCAGCAGCGCAGGTGAGGG + Exonic
1049237237 8:141518482-141518504 AGGGGCCGCAGCAGCGCTGGGGG - Exonic
1049676236 8:143890517-143890539 AGGGGGCCCACCGGGGCTGCAGG - Intergenic
1049697188 8:143990102-143990124 AGCGGCCGCCGAGCGGGTGCGGG + Exonic
1049766642 8:144358222-144358244 TGGGGCCCCGGGGCGGCTGCCGG + Exonic
1049864172 8:144922986-144923008 AGGGGCCACATGGCCGCTGCTGG + Intergenic
1050094247 9:2047312-2047334 GCGGGCGGCTGCGCGGCTGCGGG - Exonic
1052494923 9:29213454-29213476 AGGGGAGGCAGCGCCGGTGCGGG + Intergenic
1053005126 9:34599200-34599222 AGGGTCAGCAGCCCAGCTGCTGG - Intergenic
1056475368 9:86947089-86947111 CGGGGCCGTGGCGGGGCTGCAGG + Exonic
1057225292 9:93289660-93289682 AGGGGCCGGAGCCCGGGCGCAGG + Intronic
1059415135 9:114157501-114157523 AGGGTCCGCAGCGCTGGTGGAGG - Intronic
1060643866 9:125261801-125261823 CGTGGCGGCAGCGCCGCTGCAGG + Intronic
1060815367 9:126632417-126632439 AGGGGCTGCCGAGGGGCTGCTGG + Intronic
1061123116 9:128656476-128656498 CGGGGTCGCAGCGCGGCTGCCGG - Intronic
1061961740 9:133992249-133992271 AGTGGCGGCAGTGCGGCCGCTGG - Exonic
1062320899 9:135990182-135990204 AGAGGCAGCAGAGGGGCTGCTGG + Intergenic
1062464872 9:136676486-136676508 AGGGTCCTCAGCTCGGCTGGTGG + Intronic
1062479632 9:136745332-136745354 AGGGGCCGCTGAGCTGATGCTGG + Intronic
1062592619 9:137281000-137281022 GGCGGCAGCAGCGGGGCTGCCGG - Exonic
1062621234 9:137423376-137423398 AGGGGGCGCCGCGGGGCAGCGGG + Exonic
1062625977 9:137441664-137441686 GGGGTCAGGAGCGCGGCTGCGGG - Intronic
1186514746 X:10158632-10158654 TGGGGGCGCAGCCGGGCTGCAGG - Intronic
1189473546 X:41332938-41332960 AGGGGCTGCAGCGGGGTTACCGG - Intergenic
1190688850 X:52897246-52897268 AGGCGCCGCAGCGCGGAAGGGGG - Intronic
1190697133 X:52958546-52958568 AGGCGCCGCAGCGCGGAAGGGGG + Intronic
1191717767 X:64205109-64205131 AGGGGCGGCAGCCAGGCAGCCGG + Intronic
1191855266 X:65620299-65620321 CGGGGCGGCAGCGAGGCTGGGGG - Intronic
1192546509 X:72018764-72018786 GGGCGCTGCAGTGCGGCTGCGGG + Intergenic
1192561661 X:72131639-72131661 AGGGACCGAAGTGCGGCAGCGGG + Exonic
1193391011 X:80929432-80929454 AGGGGCTGCAGCGCGGAGGCAGG - Intergenic
1198277056 X:135104956-135104978 AGTGGCCCCAGCACAGCTGCTGG - Intergenic
1198584521 X:138105685-138105707 AAGGGCTGCAGCGAGGCTGGGGG + Intergenic
1198819609 X:140633317-140633339 AGAGGCGGCAGCGAGGCTGGGGG + Intergenic