ID: 913224506

View in Genome Browser
Species Human (GRCh38)
Location 1:116687168-116687190
Sequence CTCCACAGGCAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913224506_913224516 4 Left 913224506 1:116687168-116687190 CCCTCCCCATTCTGCCTGTGGAG No data
Right 913224516 1:116687195-116687217 CTGGCCCTGCTTGGGGAACAAGG No data
913224506_913224513 -5 Left 913224506 1:116687168-116687190 CCCTCCCCATTCTGCCTGTGGAG No data
Right 913224513 1:116687186-116687208 TGGAGAAGTCTGGCCCTGCTTGG No data
913224506_913224514 -4 Left 913224506 1:116687168-116687190 CCCTCCCCATTCTGCCTGTGGAG No data
Right 913224514 1:116687187-116687209 GGAGAAGTCTGGCCCTGCTTGGG No data
913224506_913224515 -3 Left 913224506 1:116687168-116687190 CCCTCCCCATTCTGCCTGTGGAG No data
Right 913224515 1:116687188-116687210 GAGAAGTCTGGCCCTGCTTGGGG No data
913224506_913224519 17 Left 913224506 1:116687168-116687190 CCCTCCCCATTCTGCCTGTGGAG No data
Right 913224519 1:116687208-116687230 GGGAACAAGGATCATATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913224506 Original CRISPR CTCCACAGGCAGAATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr