ID: 913227576

View in Genome Browser
Species Human (GRCh38)
Location 1:116713556-116713578
Sequence GAGCCACAGCTGCTGACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913227575_913227576 3 Left 913227575 1:116713530-116713552 CCTGGAACAAGAAGACATGCAGA No data
Right 913227576 1:116713556-116713578 GAGCCACAGCTGCTGACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913227576 Original CRISPR GAGCCACAGCTGCTGACAAC AGG Intergenic
No off target data available for this crispr