ID: 913227656

View in Genome Browser
Species Human (GRCh38)
Location 1:116714026-116714048
Sequence GCATCAGAGGGCCCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913227656_913227662 11 Left 913227656 1:116714026-116714048 CCCTTGAGGGGGCCCTCTGATGC No data
Right 913227662 1:116714060-116714082 CTTCTTGATGTCATCATATGTGG 0: 1
1: 10
2: 16
3: 36
4: 213
913227656_913227663 15 Left 913227656 1:116714026-116714048 CCCTTGAGGGGGCCCTCTGATGC No data
Right 913227663 1:116714064-116714086 TTGATGTCATCATATGTGGCAGG 0: 1
1: 11
2: 12
3: 18
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913227656 Original CRISPR GCATCAGAGGGCCCCCTCAA GGG (reversed) Intergenic