ID: 913230776

View in Genome Browser
Species Human (GRCh38)
Location 1:116739335-116739357
Sequence CACACTGTGTGTCTGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913230776_913230780 5 Left 913230776 1:116739335-116739357 CCTGGCCACAGACACACAGTGTG No data
Right 913230780 1:116739363-116739385 TCTGATCATCACTGAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913230776 Original CRISPR CACACTGTGTGTCTGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr