ID: 913230780

View in Genome Browser
Species Human (GRCh38)
Location 1:116739363-116739385
Sequence TCTGATCATCACTGAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913230778_913230780 0 Left 913230778 1:116739340-116739362 CCACAGACACACAGTGTGGCCTT No data
Right 913230780 1:116739363-116739385 TCTGATCATCACTGAAGCCCTGG No data
913230774_913230780 26 Left 913230774 1:116739314-116739336 CCAAGATAAACATCAATAGGACC No data
Right 913230780 1:116739363-116739385 TCTGATCATCACTGAAGCCCTGG No data
913230776_913230780 5 Left 913230776 1:116739335-116739357 CCTGGCCACAGACACACAGTGTG No data
Right 913230780 1:116739363-116739385 TCTGATCATCACTGAAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913230780 Original CRISPR TCTGATCATCACTGAAGCCC TGG Intergenic
No off target data available for this crispr