ID: 913233707

View in Genome Browser
Species Human (GRCh38)
Location 1:116762896-116762918
Sequence GGGTGGCCACAATTTTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913233707_913233710 -5 Left 913233707 1:116762896-116762918 CCAAGATAAAATTGTGGCCACCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 913233710 1:116762914-116762936 CACCCTACCCGATGACTTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 58
913233707_913233717 9 Left 913233707 1:116762896-116762918 CCAAGATAAAATTGTGGCCACCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 913233717 1:116762928-116762950 ACTTGGAGGGAAGATGGAGCTGG 0: 1
1: 0
2: 2
3: 30
4: 427
913233707_913233711 -4 Left 913233707 1:116762896-116762918 CCAAGATAAAATTGTGGCCACCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 913233711 1:116762915-116762937 ACCCTACCCGATGACTTGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 82
913233707_913233716 3 Left 913233707 1:116762896-116762918 CCAAGATAAAATTGTGGCCACCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 913233716 1:116762922-116762944 CCGATGACTTGGAGGGAAGATGG 0: 1
1: 0
2: 0
3: 8
4: 142
913233707_913233708 -8 Left 913233707 1:116762896-116762918 CCAAGATAAAATTGTGGCCACCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 913233708 1:116762911-116762933 GGCCACCCTACCCGATGACTTGG 0: 1
1: 0
2: 0
3: 3
4: 35
913233707_913233718 12 Left 913233707 1:116762896-116762918 CCAAGATAAAATTGTGGCCACCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 913233718 1:116762931-116762953 TGGAGGGAAGATGGAGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913233707 Original CRISPR GGGTGGCCACAATTTTATCT TGG (reversed) Intronic
901960826 1:12825319-12825341 GGGTGGCTGCAACTTTTTCTAGG + Exonic
901967422 1:12879921-12879943 GGGTGGCTGCAACTTTTTCTAGG + Exonic
901975220 1:12939052-12939074 GGGTGGCTGCAACTTTTTCTAGG + Exonic
901982822 1:13050185-13050207 GGGTGGCTGCAACTTTTTCTAGG + Intronic
901986199 1:13077153-13077175 GGGTGGCTGCAACTTTTTCTAGG - Exonic
901995613 1:13149614-13149636 GGGTGGCTGCAACTTTTTCTAGG + Intergenic
901999267 1:13178733-13178755 GGGTGGCTGCAACTTTTTCTAGG - Intergenic
902009955 1:13262712-13262734 GGGTGGCTGCAACTTTTTCTAGG - Exonic
902017751 1:13321865-13321887 GGGTGGCTGCAACTTTTTCTAGG - Exonic
902030815 1:13420859-13420881 GGGTGGCTGCAACTTTTTCTAGG - Exonic
902705871 1:18203944-18203966 GGCTGGCCAAGATTTGATCTGGG + Intronic
906606541 1:47176418-47176440 GGATGATCACCATTTTATCTGGG - Intergenic
907171632 1:52471410-52471432 GTGTAAACACAATTTTATCTGGG - Intronic
909433235 1:75614524-75614546 AGGGGGACACAACTTTATCTTGG - Intergenic
913233707 1:116762896-116762918 GGGTGGCCACAATTTTATCTTGG - Intronic
916783696 1:168065640-168065662 CTGTGGCCACATTTTCATCTGGG + Exonic
917487259 1:175466567-175466589 CGATGGCCACATTTTTTTCTGGG + Intronic
919165379 1:193885323-193885345 GGGTGGCCACAGCTGCATCTGGG + Intergenic
922900587 1:229133514-229133536 GTGAGGGCACAATTTTCTCTGGG - Intergenic
924422425 1:243922233-243922255 GGGTGGGCACAATTTTCTGAGGG - Intergenic
1065482385 10:26208938-26208960 GAGTGGCCATAATTTTAAGTGGG - Intronic
1071164936 10:82794867-82794889 GAGTGGCCACTATTTCATATGGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072470295 10:95707062-95707084 GGGTGGCCACAGCTATACCTGGG + Intergenic
1079120192 11:17677652-17677674 GGGTATGCACAAGTTTATCTTGG - Intergenic
1086551097 11:88052737-88052759 AGGTGGCCTCAATTTCTTCTAGG - Intergenic
1089982411 11:122783176-122783198 GGGTGGCTACCATATTTTCTCGG + Exonic
1090786589 11:130054240-130054262 GTATGACCACAATTTTCTCTAGG + Intergenic
1096802669 12:54121721-54121743 GGGTGGTCACATTGTTTTCTGGG - Intergenic
1097679390 12:62634338-62634360 GGGTGTCTTCTATTTTATCTGGG - Intergenic
1100576692 12:95898358-95898380 GGGTGGGCACAATCTTCTCGTGG - Intronic
1101534289 12:105603250-105603272 GGGTGGGCACAATCTAATCAGGG - Intergenic
1101705208 12:107214982-107215004 GGGTGCCCAAAATTTAATTTGGG - Intergenic
1112912475 13:104504973-104504995 GGGTGTCCACAATCTAATTTTGG + Intergenic
1113174108 13:107541850-107541872 GGGTGGCCACACTTAGTTCTTGG - Intronic
1116380322 14:44259615-44259637 AGCTGGCTGCAATTTTATCTTGG - Intergenic
1119352483 14:73977479-73977501 GTTTTGCCAAAATTTTATCTAGG - Intronic
1120859661 14:89243488-89243510 GGGTTGTCACAACTGTATCTAGG - Intronic
1121889868 14:97579650-97579672 GGGTGGTCACAATGTTCTATAGG + Intergenic
1125381776 15:39093292-39093314 GGTTTGCCACCATATTATCTTGG + Intergenic
1137880413 16:52040061-52040083 GTGTGGACATAATTTTCTCTTGG + Intronic
1145254382 17:21314661-21314683 GGGTGGCCACACCTCTATCCCGG + Exonic
1145322214 17:21773301-21773323 GGGTGGCCACACCTCTATCCCGG - Intergenic
1146232158 17:31121819-31121841 GGTTTGCCACAATTTTATTGAGG + Intronic
1148975911 17:51528100-51528122 GGGTGGCCAGGATTTTAGATTGG - Intergenic
1155284899 18:24277515-24277537 GGGTGGTCACCATTTTAAATAGG + Intronic
1158080989 18:53590608-53590630 TGGTTGCAAAAATTTTATCTAGG - Intergenic
1158560248 18:58507414-58507436 GTGTGGCCACTATGTTATATGGG - Intronic
1162173402 19:8809871-8809893 GAGTGGCCACAATTTTCACTGGG - Exonic
1166476659 19:43131615-43131637 TCGTGGCCACAGTTTTATCCTGG - Intronic
925433371 2:3815987-3816009 GGGTGGCAAAAATTTTTTTTGGG + Intronic
926145792 2:10396577-10396599 GGGTGGCCAGCATCTTACCTTGG + Intronic
933249650 2:80014960-80014982 GGGTGGTCAAAATTATCTCTAGG + Intronic
935129906 2:100253914-100253936 GAGTGGCCACAGCTTGATCTGGG + Intergenic
936251888 2:110873830-110873852 GGGTGGCCCCATTGTTTTCTTGG - Intronic
1169240067 20:3969621-3969643 GTGTGGCCATAGTTTTTTCTGGG - Intronic
1171035960 20:21713256-21713278 GGGCGGCCACAACTTTGTTTAGG + Intronic
1171854392 20:30331524-30331546 GGGTGGTCACATTGTTTTCTGGG - Intergenic
1177374202 21:20248013-20248035 GGCTGGCCACAACTTTAGCTTGG - Intergenic
1183656589 22:39189116-39189138 GAGTGACCACACTTCTATCTGGG - Intergenic
951617663 3:24566520-24566542 GGATGGCTACTATTTTATATAGG - Intergenic
956670491 3:71685181-71685203 GGGTGACAGCAATTATATCTAGG + Intronic
956844187 3:73167276-73167298 GTATGGCCACAATTTTTTTTTGG - Intergenic
957995431 3:87683142-87683164 CGGTGCCCACAATTTTCCCTAGG + Intergenic
963720342 3:148854816-148854838 GGGGGCCCACACTTTTATCAGGG - Intronic
966819603 3:183914479-183914501 GGGCGGCCACAATTCTACCCAGG + Intergenic
972155273 4:36153456-36153478 CTGTGGCCCCAATTTTATGTTGG - Intronic
972637994 4:40901288-40901310 AGGTGGCCACTATTTTCTCAAGG + Intronic
973171383 4:47148277-47148299 GGGTGGGCATAATTCTATTTTGG + Intronic
973549363 4:52017097-52017119 GGGTGAGTACAATTTTAACTAGG - Exonic
980858985 4:138476369-138476391 GGGTGGCCACAGATTTATCAAGG - Intergenic
981918044 4:150056335-150056357 GGGTGGCCAAAAGTATGTCTGGG + Intergenic
988087793 5:26494096-26494118 GCCTAGCCACAAATTTATCTGGG - Intergenic
992542623 5:77779771-77779793 GGGGGTTCACAATTTTATTTTGG - Intronic
994912506 5:105930428-105930450 GTGTTGGCACAATTTTATTTAGG + Intergenic
998223891 5:140311229-140311251 GAGTGGCCACAATTCTGTTTGGG - Intergenic
998820155 5:146050812-146050834 GGGTGGTTACAATTTTAGATAGG + Intronic
1000165051 5:158640185-158640207 TTGTTGCCACAATTCTATCTAGG - Intergenic
1002579740 5:180200671-180200693 AGGTGGCCACCATTATCTCTGGG - Intronic
1003641482 6:7878938-7878960 GGGTGACCATACTTGTATCTAGG + Intronic
1005182203 6:23118588-23118610 GGGTGCTCACAATTTTACTTTGG + Intergenic
1007260930 6:40562514-40562536 GGGTGGACCCCATTTTCTCTTGG - Intronic
1013395389 6:109732240-109732262 GGGTCACCACAATTTTAAGTTGG - Intronic
1016262785 6:142193244-142193266 GGGAGGACACAACTTTATTTTGG - Intronic
1017110291 6:150925700-150925722 GGCTGGCCACATGTTTCTCTTGG - Intronic
1018504162 6:164445818-164445840 GGGTGGCCACAGTTTAAACTGGG + Intergenic
1018651272 6:165993037-165993059 GGCTGGCAACAACTTGATCTTGG + Intergenic
1018819669 6:167364244-167364266 GGGTGTCCTATATTTTATCTGGG - Intronic
1020716388 7:11678944-11678966 GGTTTGCCAGAATTTTATCGAGG - Intronic
1022108152 7:27211327-27211349 GGTTGGCTTCAATTTTATCTGGG + Intergenic
1022616630 7:31937588-31937610 GGGTGCCTAGAATTTTATTTTGG + Intronic
1025862731 7:65347063-65347085 GGGTTGCCACTATTTTATTGAGG + Intergenic
1030055262 7:105578754-105578776 GAGTGGACACAATTTTAACTTGG - Intronic
1030753041 7:113255419-113255441 AGTTGGCCACATTTTGATCTTGG + Intergenic
1034476146 7:151283677-151283699 GGGTGGCCCCAATTTGAGATTGG - Intergenic
1043006401 8:74824384-74824406 GGGTGGCAACCTTTTTATGTGGG - Intergenic
1043393120 8:79810306-79810328 GGGAGGCCACATTTATTTCTTGG + Intergenic
1045230972 8:100307097-100307119 AGGTGGCCTAATTTTTATCTTGG + Intronic
1047753271 8:127898766-127898788 GTGTGGCCACTATTTTAACAAGG - Intergenic
1051274717 9:15387714-15387736 GGATGGCCTCTATTTTATCTAGG + Intergenic
1054152953 9:61619963-61619985 GGGTGGTCACATTGTTTTCTGGG + Intergenic
1054180615 9:61906820-61906842 GGGTGGTCACATTGTTTTCTGGG - Intergenic
1054472741 9:65551166-65551188 GGGTGGTCACATTGTTTTCTGGG + Intergenic
1054656976 9:67674322-67674344 GGGTGGTCACATTGTTTTCTGGG + Intergenic
1058783993 9:108367789-108367811 GAGTAGCCACAATTTCATGTTGG + Intergenic
1185861774 X:3586350-3586372 GGGTGTCCTGTATTTTATCTGGG + Intergenic
1187954097 X:24498630-24498652 GGGTGGTCCCATTTTTCTCTGGG - Intronic
1191910888 X:66148326-66148348 GGGTGGCCTGGATTTGATCTTGG - Intergenic
1196854465 X:119969975-119969997 TAGTGGCCCTAATTTTATCTGGG + Intergenic
1197100018 X:122641765-122641787 GGCTGGGCACAATTTTTTCCAGG + Intergenic
1197204166 X:123775309-123775331 GAGTGGCCACAGCTTTCTCTTGG - Intergenic