ID: 913234423

View in Genome Browser
Species Human (GRCh38)
Location 1:116767645-116767667
Sequence CAGTGGCTCCAGAGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 385}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913234423_913234431 -1 Left 913234423 1:116767645-116767667 CCTACCTCCCTCTGGAGCCACTG 0: 1
1: 0
2: 1
3: 40
4: 385
Right 913234431 1:116767667-116767689 GCAAAGACGGCCTTGGGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
913234423_913234432 0 Left 913234423 1:116767645-116767667 CCTACCTCCCTCTGGAGCCACTG 0: 1
1: 0
2: 1
3: 40
4: 385
Right 913234432 1:116767668-116767690 CAAAGACGGCCTTGGGTGCAGGG No data
913234423_913234429 -7 Left 913234423 1:116767645-116767667 CCTACCTCCCTCTGGAGCCACTG 0: 1
1: 0
2: 1
3: 40
4: 385
Right 913234429 1:116767661-116767683 GCCACTGCAAAGACGGCCTTGGG No data
913234423_913234428 -8 Left 913234423 1:116767645-116767667 CCTACCTCCCTCTGGAGCCACTG 0: 1
1: 0
2: 1
3: 40
4: 385
Right 913234428 1:116767660-116767682 AGCCACTGCAAAGACGGCCTTGG 0: 1
1: 0
2: 1
3: 18
4: 129
913234423_913234434 29 Left 913234423 1:116767645-116767667 CCTACCTCCCTCTGGAGCCACTG 0: 1
1: 0
2: 1
3: 40
4: 385
Right 913234434 1:116767697-116767719 ATACCTAACTTACAGCCTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913234423 Original CRISPR CAGTGGCTCCAGAGGGAGGT AGG (reversed) Intronic
900187239 1:1338139-1338161 CAGTGGCTCCAGTGGGACTTCGG - Exonic
900417956 1:2543638-2543660 CTGTGGCTCCTGCGTGAGGTGGG + Intergenic
900650381 1:3727400-3727422 CTGGGCCTCCGGAGGGAGGTGGG + Intronic
900925621 1:5704373-5704395 AGGAGGCTGCAGAGGGAGGTGGG + Intergenic
901415421 1:9112871-9112893 TAGTGGCTCCTGAGAGAGGCAGG + Intronic
901814187 1:11784697-11784719 CAAAGGCTCAAGAGGGTGGTTGG + Intronic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902374675 1:16024768-16024790 CAGTGGCTGTACAGGGAGATTGG + Exonic
902379622 1:16046540-16046562 CAGTGGCTGTACAGGGAGATTGG + Exonic
902658243 1:17884199-17884221 CAGGGGCTGCAGAGGTAGGCAGG + Intergenic
903575092 1:24334744-24334766 AAGAGGCTCCAGGTGGAGGTGGG - Intronic
903706566 1:25290183-25290205 CAGTGGCCCCAGATGGGGATGGG + Intronic
904079112 1:27860963-27860985 CAGTGGAGCAAGTGGGAGGTCGG - Intergenic
904804041 1:33118503-33118525 CTGTGACTGCAGAGGGAGGCAGG + Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905389422 1:37626664-37626686 TAGAGGCTCCAGATGGAGGATGG + Intronic
905649625 1:39647564-39647586 CAGTGGCAGAATAGGGAGGTCGG - Intergenic
905731659 1:40302802-40302824 CAGTTGCTCTGGAGGGAGGGAGG + Exonic
905774830 1:40661842-40661864 CTCTGGCTCCCCAGGGAGGTTGG + Intronic
907097304 1:51793422-51793444 CAGAGGCTCCAGAGAGAAGCAGG + Intronic
907489586 1:54800556-54800578 CAGTCCTCCCAGAGGGAGGTAGG + Intronic
908554770 1:65246849-65246871 CAGTGGCTCCAGAGGCATTTGGG + Intergenic
909736404 1:78967967-78967989 CTGAGGCTCCAGAGGGTGCTTGG + Intronic
913144777 1:115977819-115977841 CAGTGGCTCAACAGGAAGATGGG + Intronic
913234423 1:116767645-116767667 CAGTGGCTCCAGAGGGAGGTAGG - Intronic
915003088 1:152611494-152611516 CATTGGCAGCTGAGGGAGGTAGG - Intergenic
915300254 1:154947611-154947633 GAATGTCTCCAGAGGCAGGTGGG - Intronic
915916004 1:159941429-159941451 CAAGAGCTCCAGACGGAGGTAGG + Intronic
916785338 1:168083047-168083069 GTGTGGCTTCAGAGGGAGGTGGG - Exonic
917121922 1:171652247-171652269 GAGGGGCTGCAGAGGGAGCTGGG - Exonic
917377573 1:174365695-174365717 CGGTGGCTGCTGAGGGATGTGGG + Intronic
917522924 1:175762953-175762975 CAGTGCCTTCAGAGGGAGCGTGG + Intergenic
919705345 1:200670024-200670046 CAGTGGCTTGGGAGGGAGGGAGG + Intergenic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
919881778 1:201905761-201905783 GAATGGCTCCAGCAGGAGGTTGG + Intronic
920069014 1:203289331-203289353 CACTGGCTCCTGAGGAAGGAAGG + Intergenic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920739736 1:208569150-208569172 CAGAGGCTGGTGAGGGAGGTGGG + Intergenic
922236011 1:223723270-223723292 CAGTGGCTCCAGAACCAGGCTGG - Intronic
922550953 1:226493960-226493982 CAGTGTCTCCAGAGGGAGTCAGG - Intergenic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
923372775 1:233328836-233328858 AAGTGGGGCCAGAGGGAGGTGGG + Intronic
923933136 1:238726510-238726532 CAGTGACACCAGAGGAAGGGAGG + Intergenic
1063313788 10:4982573-4982595 CAGTGGGTCCAGGGTTAGGTGGG - Exonic
1065732530 10:28722449-28722471 CAGTGGACCCAGAGCGAGGTGGG - Intergenic
1066491518 10:35899328-35899350 CCGTGGCTGCAGATGGAGGATGG + Intergenic
1068077083 10:52269880-52269902 CAGTGGCTCCAGAGGAGGCATGG - Intronic
1069562274 10:69439310-69439332 CTGTGGCTATAGAGGAAGGTGGG - Intergenic
1069967765 10:72135608-72135630 CAGTAGTTACAGAGTGAGGTGGG + Intronic
1070259184 10:74837698-74837720 CAGTGGGGCCAGTGGGATGTTGG + Intronic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1070818792 10:79342731-79342753 CTGTGTCTCCAGGGGCAGGTGGG - Intergenic
1071526531 10:86362865-86362887 CAGTGGGTGTAGTGGGAGGTGGG - Intronic
1073152771 10:101323104-101323126 AAGTGGAGGCAGAGGGAGGTAGG + Intergenic
1075669100 10:124251026-124251048 CATTGGCTCCAGACCAAGGTGGG + Intergenic
1076691026 10:132223980-132224002 CAGTGCCTCCTGGGGAAGGTGGG - Intronic
1076780882 10:132723777-132723799 CAGAGGCTCCCGAGGGAGGGCGG - Intronic
1077148347 11:1055993-1056015 CAGGGGCCCAAGAGGAAGGTGGG + Intergenic
1077522742 11:3045954-3045976 CAGGGGCTGAAGGGGGAGGTGGG - Intronic
1077698740 11:4419837-4419859 CAGTGGATCCTCAGGAAGGTAGG + Intergenic
1079106739 11:17576851-17576873 CAGTGGCTGCAGAGAGAGACGGG - Exonic
1079271122 11:18987023-18987045 CAGTGGCTGCTGTGGGAGATAGG + Intergenic
1079775518 11:24520943-24520965 CATTAGCTCCAGAGGGAAATAGG + Intronic
1080771309 11:35344702-35344724 CATTGTCTGAAGAGGGAGGTTGG - Intronic
1081601586 11:44498920-44498942 CAAAGGCTCCAGAGAGAAGTGGG + Intergenic
1082928774 11:58578701-58578723 CAGTGGCTCCTCAGGGAGGCAGG + Intergenic
1083878362 11:65536558-65536580 CAGTGGCATGAGAGAGAGGTGGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085398240 11:76218549-76218571 CACTGGCTTGAGAGGGAGGCTGG + Intergenic
1086593110 11:88539715-88539737 AAGTAGGTCCAGATGGAGGTAGG - Intronic
1087074308 11:94114957-94114979 TAGAGCCTCCAGAGAGAGGTTGG + Intergenic
1088576730 11:111279443-111279465 CAGAGGCTCCAGAGGGAGCATGG - Intronic
1088961579 11:114671605-114671627 CAGTGGCACCAGAAGGCAGTAGG + Intergenic
1089109277 11:116042254-116042276 GAGAGGCTCCAGAGTGAGGATGG - Intergenic
1089911539 11:122105604-122105626 CATTTGCTGCAGTGGGAGGTGGG - Intergenic
1090653422 11:128825255-128825277 CAGTGGCTCCAGAGAGGTGAGGG - Intergenic
1091364012 11:135001805-135001827 CAGTGGCCTCAGAGGAAGGAGGG + Intergenic
1091946466 12:4549159-4549181 AAGAGGCTCGAGAGGGAGGCTGG + Intronic
1092992930 12:13920610-13920632 GAGAGGCTCCAGACTGAGGTGGG + Intronic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1093726595 12:22519043-22519065 GAGTGGCTGCAGAGGCAGGCAGG - Intronic
1093886330 12:24465832-24465854 CAGAGGCTCCAGAGGGCTTTCGG + Intergenic
1094479385 12:30869664-30869686 AGGAGGCACCAGAGGGAGGTTGG - Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1096154601 12:49334986-49335008 CACAGGCTGCAGAGGGAGGTTGG - Intronic
1096761590 12:53846082-53846104 CAGTGACTGCAGTGGGAGGGTGG - Intergenic
1097218914 12:57435354-57435376 GAGTGACCCCAGAGGGATGTGGG - Intronic
1100280847 12:93116810-93116832 CAGTGGCTGCACTTGGAGGTGGG - Intergenic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1104084488 12:125461494-125461516 TAGTTGCTGCAGAGGGATGTGGG + Intronic
1104558834 12:129825600-129825622 CAGTGGCTCCAGATGCAGCAAGG - Intronic
1104802917 12:131566855-131566877 TTCTGGCTCCAGAGGGAGCTGGG + Intergenic
1105430688 13:20334550-20334572 CAGTGGTGGCAGTGGGAGGTGGG - Intergenic
1106133551 13:26958393-26958415 GGGTTGCTCCATAGGGAGGTGGG + Intergenic
1106606822 13:31236114-31236136 TTCAGGCTCCAGAGGGAGGTGGG + Intronic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1107606583 13:42063574-42063596 CAGTGGCTGGAGAGGGATGCTGG + Intronic
1109797231 13:67331683-67331705 AAGTGGCTCCAAAGGGAAGGGGG - Intergenic
1111721828 13:91956023-91956045 CAGTGGCTGGGGAGGGTGGTTGG - Intronic
1111816283 13:93157239-93157261 CAGTGCCTTCAGAGGGAGCATGG - Intergenic
1112201865 13:97284257-97284279 CAGGGGCTTCAGAGGGAGCGTGG - Intronic
1113737677 13:112690028-112690050 CGGAGGCTCCAGAGGGCGGCGGG + Intergenic
1117925669 14:60776714-60776736 AAGTGGTTCCAGAGGGTGATGGG + Intronic
1118819855 14:69338167-69338189 AACTGGGTCAAGAGGGAGGTTGG + Intronic
1119216942 14:72876400-72876422 GAGAGGCTCCAGGGGGAGGGTGG - Intronic
1121414233 14:93767918-93767940 CAGTGGCTGCAGGGGATGGTAGG + Intronic
1121452063 14:94014986-94015008 CACTGAATTCAGAGGGAGGTTGG + Intergenic
1121567676 14:94923002-94923024 CTATGGATCCAGAGGGAGCTGGG - Intergenic
1122300288 14:100727374-100727396 AAGTGGCGCCAGAGGGGTGTCGG + Intronic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122510689 14:102264825-102264847 CTGTGGCTCCGGAGGGAGCCTGG - Intronic
1122907237 14:104807503-104807525 CAATGGCCCCAGAGGGAGGCAGG - Intergenic
1123787934 15:23690923-23690945 CAGTGGCCCCCTAGGGAGGCTGG - Intergenic
1125080320 15:35665016-35665038 GAGTGGCTCCAGAAGTATGTAGG - Intergenic
1125236843 15:37524618-37524640 CAGAGGCTCCAGAGGGAGCATGG - Intergenic
1128147535 15:65340271-65340293 GACAGGCTCCAGGGGGAGGTGGG + Intronic
1129461046 15:75700268-75700290 CAATGGCCCCAGTGGGAGGAGGG + Intronic
1129723774 15:77891457-77891479 CAATGGCCCCAGTGGGAGGAGGG - Intergenic
1130394300 15:83488721-83488743 AAGTGGCTGCAGAGGCAGCTGGG - Intronic
1130403459 15:83578272-83578294 CAGGGGCTCCGGAGGGAGGCAGG - Intronic
1130881879 15:88062404-88062426 CATTGGCTGCAAGGGGAGGTGGG - Intronic
1132253614 15:100354207-100354229 CAGTGAATCCAGAGAGAGATGGG - Intergenic
1134008226 16:10832680-10832702 CAGAGTCTCCAGTGGGAGGGGGG + Intergenic
1134644223 16:15853529-15853551 CAGTGGCTGAAAGGGGAGGTCGG - Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1135399952 16:22159843-22159865 CAGTGTCTTCAGAGGGAGCATGG - Intergenic
1135423936 16:22323018-22323040 CAGAGGCTCCAGGTGGAGGCGGG + Intronic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1136061082 16:27726887-27726909 GAGAGGTCCCAGAGGGAGGTGGG + Intronic
1136779573 16:32887716-32887738 CAGAGGCTCGAGAGGGATGTAGG + Intergenic
1136891043 16:33973802-33973824 CAGAGGCTCGAGAGGGATGTAGG - Intergenic
1137883698 16:52079336-52079358 TTCTGGCTCCAGAGGGAGGAAGG + Intergenic
1138247063 16:55475639-55475661 CAGAGGCTTCAGAGGGAGCGTGG - Intronic
1138517367 16:57543640-57543662 CAGGGGCTCCAGACTGTGGTTGG + Intronic
1138650769 16:58459903-58459925 CAGTTTCTCTAGTGGGAGGTGGG - Intergenic
1138933972 16:61696286-61696308 AAGTGGCTCCAGTGGAAAGTGGG + Intronic
1139558478 16:67727497-67727519 CCGTGGCTCCAGAGGGAGACAGG + Intronic
1139625674 16:68186969-68186991 AAGTGGCCCCAGAGGGCTGTGGG - Intronic
1140225069 16:73070609-73070631 CAGTGCCTGCCGAGGGAGGGCGG - Intergenic
1140916798 16:79501116-79501138 CAGGGTCTCCAGAGGGAGTGTGG - Intergenic
1140997275 16:80273058-80273080 AAGAGCCTCCAGAGGGAGCTTGG + Intergenic
1141626875 16:85266105-85266127 CCGAGGCTCCCCAGGGAGGTGGG + Intergenic
1141805684 16:86340064-86340086 CAGAGGCTGGAGAGGGAGGTGGG - Intergenic
1141863046 16:86731013-86731035 CACTGGCTGCAGCGGGAGGATGG + Intergenic
1142075552 16:88115655-88115677 CAGAGCCTCCAGAGGGAGTACGG - Intronic
1142263946 16:89055007-89055029 CAGCAGCTGCAGAGGAAGGTGGG - Intergenic
1142357404 16:89608403-89608425 AAGTGACTCCAGAGGGAGCCGGG - Intergenic
1203081989 16_KI270728v1_random:1149804-1149826 CAGAGGCTCGAGAGGGATGTAGG + Intergenic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1143352452 17:6298714-6298736 CAGAGGCTCCAAAGGGAGTGTGG - Intergenic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144756857 17:17685164-17685186 GTGTGGCTCCACAGGGAGGGAGG + Intronic
1144875354 17:18394479-18394501 CAGAGGATCCCGGGGGAGGTAGG + Intergenic
1144930603 17:18855977-18855999 CACTGGCTTCAGAGGGTGGAGGG + Intronic
1145156871 17:20549942-20549964 CAGAGGATCCCGGGGGAGGTAGG - Intergenic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147155339 17:38541982-38542004 CAGAGGCTCCAGGTGGAGGCTGG + Intronic
1147160195 17:38565033-38565055 CAGAGGCTCCTGGGGGAGGCTGG - Intronic
1147228947 17:39003186-39003208 CTGTGGCTCGAGGGGGAGGAGGG - Intergenic
1147459544 17:40559469-40559491 GAGTGTCTCCTGAGGGAGGTGGG + Intronic
1147607787 17:41784268-41784290 CAGAGGCTCCAGAGGGAATGGGG + Intronic
1147678620 17:42224708-42224730 AGGTGGGTCCAGAGGGAGGTGGG + Intronic
1147987328 17:44314220-44314242 CTGTGGGTTCACAGGGAGGTTGG + Intronic
1148804424 17:50257205-50257227 CAGCTTCTCCACAGGGAGGTAGG - Intergenic
1150004814 17:61463081-61463103 AGGTGGCTCCAGAAGGAGGAAGG - Intronic
1150085893 17:62273097-62273119 CAGAGGATCCCGGGGGAGGTAGG - Intronic
1151148022 17:72059137-72059159 CAGTGGCTCAAGCGGCAGTTTGG + Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1151459840 17:74248083-74248105 CAGTGGCTCCTGAAGGAGGACGG + Intronic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151824030 17:76513573-76513595 CAGAGGCTTCAGAGGGAGTGTGG + Intergenic
1151903713 17:77034475-77034497 CTGAGGCTCCAGGGGCAGGTGGG + Intergenic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152067404 17:78119202-78119224 CTGTGGCCCCAGGGGGAGGCAGG + Intronic
1152103663 17:78316726-78316748 CAGGGGTCCCAGAGGGTGGTGGG - Intergenic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1152410221 17:80119347-80119369 TAGTCTCTCCAGAGGGAGGCTGG + Intergenic
1152497320 17:80682630-80682652 CAGGGCCTCCAGAGGGAGCGTGG + Intronic
1152588770 17:81200840-81200862 CCGTGGCTCCACAGAGAGGGTGG + Intronic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1153025550 18:669242-669264 CAGAGGCACCTGAGGGAGGCAGG + Intronic
1153107243 18:1541793-1541815 CAGAGGCTCCAGCGGGAGAGAGG - Intergenic
1153587388 18:6637126-6637148 AACTGGCTGCAGAGGGAGGATGG - Intergenic
1155621763 18:27787380-27787402 CTGGAGCTCCAGAGGGAGTTTGG + Intergenic
1157302463 18:46488934-46488956 CATTGGCTCAGGAGGGAGGCAGG - Intronic
1157598483 18:48878262-48878284 CCATGGCTCCGGGGGGAGGTAGG - Intergenic
1157609824 18:48949463-48949485 AAGGGGGTGCAGAGGGAGGTGGG - Intronic
1158314989 18:56202170-56202192 CAGTAGCTATAGAGAGAGGTAGG - Intergenic
1158537901 18:58324468-58324490 CTGTTGCTCCCCAGGGAGGTGGG - Intronic
1160333469 18:78016361-78016383 CAGTGGCACCTGAGGGGCGTGGG + Intergenic
1160948439 19:1654319-1654341 CAGGGGCTCCAGATAGGGGTGGG - Intergenic
1161267180 19:3369752-3369774 CGGTGGCGCCAGCGGGAGGGAGG - Intronic
1161570902 19:5030452-5030474 CAGAGCCTGCAGAGGGGGGTGGG + Intronic
1162641575 19:12014467-12014489 CAATGGCACCTGAGGGAGGTAGG - Intergenic
1163688250 19:18724556-18724578 CAGAGCCTCCAGAGGAAGCTCGG - Intronic
1163699367 19:18779632-18779654 CAGTGGCGCCCGCCGGAGGTTGG - Exonic
1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165429450 19:35764185-35764207 CAGTGACTCCAGTGGGAAGTGGG + Intronic
1165454208 19:35901252-35901274 TACTGGGTCCAGAGGGAGGCAGG + Intronic
1166186268 19:41141140-41141162 CTGGGGCTCCAGAGGCAGGCGGG + Intergenic
1166563309 19:43747732-43747754 CAGGGGCTGCAGGGGGTGGTGGG + Exonic
1166981647 19:46635077-46635099 CAGTGGCTCCAGGGAGAACTGGG + Intergenic
1167169802 19:47823545-47823567 CAGAGGCTGCAGAGAGAGGCTGG + Intronic
1167249500 19:48392711-48392733 CAGGGGCTCCTGAGGTAGTTTGG - Intergenic
1167917891 19:52756954-52756976 TAGTGGCTCCCCAGGGAGGCTGG + Intergenic
1168413371 19:56153828-56153850 CTGGGGCTCCAGAGGCAGCTGGG + Intronic
1168456331 19:56511716-56511738 CAGTGGCCCCTGAGAGAAGTGGG - Intronic
1168564574 19:57412281-57412303 CATTGGGTCCAGACGGGGGTAGG + Intronic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925286193 2:2717164-2717186 CACTGGCTTGAGATGGAGGTGGG - Intergenic
925608005 2:5678699-5678721 TATAGGCTCGAGAGGGAGGTAGG - Intergenic
925672289 2:6324119-6324141 CAGTGGCTGTAGAGGAAGTTGGG - Intergenic
926606709 2:14905494-14905516 CAGGGGCACCAGAGAGAGTTGGG - Intergenic
927062067 2:19432621-19432643 CAGTAGCCCCAGAGCGAGGAGGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
931212254 2:60208354-60208376 CAGTGGAGACAGAGGCAGGTTGG - Intergenic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933767995 2:85723915-85723937 CAGTTACTCAGGAGGGAGGTGGG - Intergenic
933798517 2:85941276-85941298 CAGAGCCTCCAGAGGGAGCAAGG - Intergenic
934097913 2:88624682-88624704 CAGGACATCCAGAGGGAGGTAGG - Intronic
934534433 2:95121585-95121607 CAGCGGCTCCGGCGGAAGGTGGG + Intronic
935723524 2:106000586-106000608 GAGTGGGACCGGAGGGAGGTAGG - Intergenic
936086699 2:109474207-109474229 CAGTGGCTCTCTAGGGAGGTGGG + Intronic
936308204 2:111360744-111360766 CAGTTGGTCCAGAGGTAGGCAGG - Intergenic
936654222 2:114466000-114466022 TAGTGATTCCAGAGGCAGGTAGG - Intronic
937087152 2:119179030-119179052 CTGAGGCTCCAGAGAGATGTTGG + Intergenic
937643685 2:124242238-124242260 CAGTGGCTCCAGATGGACCTGGG + Exonic
937904528 2:127046391-127046413 CTGCGGATCCAGAGGGAGGGAGG - Intergenic
938232311 2:129671659-129671681 CTGTGGCTCCAGAGGAAGTGTGG + Intergenic
941643956 2:168019631-168019653 CAGTGCCTGCAGTGGGAGGATGG + Intronic
941857587 2:170246636-170246658 CAGAGGCTTCAGAGGGAGCATGG + Intronic
942068783 2:172296550-172296572 CAGTAGGTCCAGGAGGAGGTGGG - Intergenic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
944476319 2:200110417-200110439 GAGTAGTACCAGAGGGAGGTAGG - Intergenic
944490374 2:200252822-200252844 CACTGGCTGCAGTGGTAGGTGGG - Intergenic
944889730 2:204104967-204104989 CAGTGGTTCCAGAGGGTTCTCGG + Intergenic
944891414 2:204120904-204120926 CAGTGGCTACAGAGGCAGCCAGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
948303002 2:236922378-236922400 CAGTGGATGGAGAGGAAGGTTGG + Intergenic
948640209 2:239370959-239370981 CAGTGGCTCCAAAGGGCAGAGGG - Intronic
948676596 2:239600664-239600686 GGGAGGCTCCAGAGGGAGGTTGG + Intergenic
948907359 2:240986276-240986298 CATCCGGTCCAGAGGGAGGTGGG - Intronic
1168813279 20:720116-720138 CAGAGTCTCCAGCTGGAGGTTGG + Intergenic
1169358027 20:4924288-4924310 CTCTGACTCCAGAGGGAGGACGG - Intronic
1171420666 20:25015179-25015201 GAGTGGCTTCACAGGGTGGTGGG - Exonic
1172522723 20:35578831-35578853 CAGGAGCTCCAGGGGCAGGTGGG - Intergenic
1172941326 20:38656643-38656665 CATTGGCCCCTGTGGGAGGTGGG + Intergenic
1175140812 20:56859307-56859329 CTGTGTCTCCTGGGGGAGGTGGG + Intergenic
1175269445 20:57723534-57723556 CAGGAGCTGCAGAGGCAGGTGGG + Intergenic
1175285635 20:57834897-57834919 CAGAGCCTCCAGAGGGAGTACGG - Intergenic
1176037596 20:63047780-63047802 TGGTGGCTCCAGAGGAATGTTGG + Intergenic
1176220809 20:63968696-63968718 GAGAGGATCCAGAGAGAGGTGGG - Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1180199634 21:46216474-46216496 CAGTGGCACCAGAGTGTGGAGGG + Exonic
1181022900 22:20112840-20112862 CAGGGGCTCCTGTGGGAGCTGGG + Intronic
1181102455 22:20550549-20550571 CAGTGACTCAGGAGGAAGGTTGG + Intronic
1182435781 22:30328814-30328836 CAGTGACTCCAGACAGTGGTGGG + Intergenic
1182477353 22:30583379-30583401 CAGGGGCTCCAGGGGGAGCTGGG - Intronic
1182784008 22:32891435-32891457 CAGTGGCTGGAGTGGGATGTGGG - Intronic
1183177772 22:36237126-36237148 CAGAGGCTCCAGACAAAGGTGGG - Intronic
1183524175 22:38314050-38314072 CAGGGGCTCCAGCTGGAGCTAGG + Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1183671253 22:39274215-39274237 CACTGGCCCCAGAGGAAGGGGGG - Intergenic
1184611480 22:45606755-45606777 CAGTGGCTCCTGGGTGGGGTTGG + Intergenic
1185046699 22:48532027-48532049 CTGTGCATCCAGAGGAAGGTGGG + Intronic
1185416365 22:50712521-50712543 CAGTGGGTCGAGAGAGAGGGAGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949642416 3:6052758-6052780 CAGTGGCTGCAGTGGTTGGTCGG + Intergenic
950181921 3:10919465-10919487 CTGGGGCTTGAGAGGGAGGTGGG - Intronic
950699033 3:14727390-14727412 CAGGGGCTCCAGATGGATGATGG - Intronic
952269197 3:31815809-31815831 GAGTGGCTGCAGAGAGACGTTGG - Intronic
953788630 3:45929647-45929669 GAAGGGCTCCAGAGGTAGGTAGG + Intronic
954608146 3:51929540-51929562 CAGTGTCCCCAGAAAGAGGTGGG + Intergenic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
955942263 3:64157751-64157773 GAGTGGCTGGGGAGGGAGGTGGG + Intronic
957717422 3:83946752-83946774 TAGTGCCTCCAGAGGGAGTGTGG + Intergenic
958992298 3:100860856-100860878 CAGGTGCTCCTGAGGGATGTGGG + Intronic
959465560 3:106682013-106682035 CTGTGGCACAAGAGGGATGTGGG + Intergenic
961745024 3:129059279-129059301 CAGAGGCTCAAGAGGAAGGAGGG + Intergenic
963941981 3:151104757-151104779 TAGAGGCTTCAGAGGGAGGATGG - Intronic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
966405292 3:179591283-179591305 CTGTGGCTCCAGAGAGAGACAGG - Intronic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
968472287 4:787663-787685 CAGAGCCTCCAGAGGGAGTGTGG + Intronic
968880427 4:3295976-3295998 CAGTGCCTCGGGAGGGAGCTTGG - Intronic
969149771 4:5159332-5159354 CAGTGGCTCCCTAGGCTGGTAGG + Intronic
969239538 4:5889459-5889481 ATGTTGCTCCAGAGGGAGGTGGG + Intronic
969352583 4:6606315-6606337 CAGTGGCTCCTGAGGGAAAGTGG + Intronic
969757118 4:9157188-9157210 CACTGGCTCCCGTGGGAGGGAGG + Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
970986983 4:22170485-22170507 TAGTGCCTCCACAGGGAGATTGG + Intergenic
971599257 4:28571168-28571190 TAGAGCCTTCAGAGGGAGGTAGG + Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
978896519 4:113895103-113895125 CAGTGGTTGCAGATGGAAGTTGG - Intergenic
979529586 4:121755022-121755044 CACTGGGTCCAGTTGGAGGTGGG + Intergenic
981413395 4:144459066-144459088 CAGTGGATCCAGAGAGAGTGTGG + Intergenic
981477022 4:145197350-145197372 CAGAGGCACAAGAGGGAGATTGG + Intergenic
982761543 4:159290146-159290168 CAGTGGCACCACAGTGAAGTGGG + Intronic
984782891 4:183541886-183541908 CACTGGCTCCTCAGGGAGGGTGG + Intergenic
985192659 4:187393139-187393161 CGGTGGCTGAAGAGGGAAGTCGG - Intergenic
986195438 5:5533404-5533426 CAGTGGCTCTGTGGGGAGGTCGG + Intergenic
986210757 5:5669649-5669671 CTGGGGCTGCACAGGGAGGTAGG - Intergenic
987739474 5:21887524-21887546 CAGTGTCTCCAGAGGAAGAATGG - Intronic
993042884 5:82835581-82835603 CAGTGGCTCCAGTGGTACCTGGG + Intergenic
994403157 5:99308336-99308358 GAGTGGCTTCAGAGGGATATTGG + Intergenic
997109987 5:131064491-131064513 CAGTGGCTAGAAAGGCAGGTAGG + Intergenic
997599655 5:135130635-135130657 CCCTTGCTCCAGAGGGAGGTTGG - Intronic
997799466 5:136845222-136845244 CAGAGGCTTCAGAGGGAGCATGG + Intergenic
998502519 5:142645841-142645863 CAGTGACTGTGGAGGGAGGTTGG - Intronic
998878162 5:146620826-146620848 CAGAGGCTCCCCAGGGAGTTCGG - Intronic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1001035247 5:168292320-168292342 CGGCGGCTCCAGGGGCAGGTGGG - Intronic
1001537446 5:172508228-172508250 CAGAGCCTCCAGAGGGAGCCTGG + Intergenic
1001571335 5:172732462-172732484 CAGATGCTGCAGAGGGAGGGAGG + Intergenic
1003635261 6:7826107-7826129 CAGTGGTGCCTGAGGGTGGTTGG + Intronic
1005462509 6:26082669-26082691 CAGAGGCTACAGAGGGATCTTGG - Intergenic
1005502502 6:26442122-26442144 CAAGGTCTGCAGAGGGAGGTGGG - Intronic
1007121120 6:39382322-39382344 CAGAGACTCCAAAAGGAGGTAGG - Intronic
1007366592 6:41398408-41398430 CAGTGGCTGCAGGGGGACATTGG - Intergenic
1007558723 6:42787849-42787871 TAGTGGCTTCAGAGGGAGATGGG + Intronic
1007755272 6:44095374-44095396 CAGAGGCTGTAGAGAGAGGTGGG + Intergenic
1007776398 6:44226678-44226700 CAGGGGCTCCCCAGGGAGGGTGG + Intronic
1007966173 6:46005509-46005531 CAATTGCTCCACAGGCAGGTAGG + Intronic
1008679377 6:53856307-53856329 CAGTGGCTCTTGAGGGATTTAGG + Intronic
1008845870 6:55963501-55963523 GAGTGGCGCCAGCTGGAGGTTGG - Intergenic
1011295710 6:85825107-85825129 CTGTGGCTTCAGTGGGAGTTGGG - Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1013435572 6:110102026-110102048 CAGTGGCTGGAGGTGGAGGTGGG + Exonic
1013911655 6:115282680-115282702 CTGAGGCCCCAGAGGGAGGGTGG - Intergenic
1015666346 6:135634049-135634071 CAATGGGTACAGAGGCAGGTAGG - Intergenic
1015962177 6:138661280-138661302 CAGGGGCTGGAGTGGGAGGTGGG - Intronic
1016037165 6:139395408-139395430 CAAGGACTCCAGAGGGAGTTGGG + Intergenic
1016471887 6:144383330-144383352 CAGTGGCACCAGATTGAGTTAGG + Intronic
1017550242 6:155498171-155498193 CAGTGGTTACAGAGGGAGTTTGG + Intergenic
1018290856 6:162291452-162291474 ACGTGGCACCAGAGGGTGGTGGG - Intronic
1018788852 6:167130974-167130996 GAGGGGGTCCAGAGGGAGGGTGG - Intronic
1019310949 7:360339-360361 CAGTGGCTTCTGAGAGAGGAGGG - Intergenic
1019503411 7:1377083-1377105 CAGGGGCTGCAGAGGTGGGTGGG + Intergenic
1019519632 7:1454832-1454854 CAGTGGCTCCCAAGGGTGGCGGG - Intronic
1020230957 7:6318091-6318113 CAGTGGCTCTAGAGGGAGAGGGG + Intergenic
1021919295 7:25467935-25467957 CCATGACTACAGAGGGAGGTGGG - Intergenic
1022232073 7:28423818-28423840 GAGTGGCTCCACAGGGAGAAAGG + Intronic
1022412592 7:30150677-30150699 CAGTGGCTTCATGAGGAGGTGGG + Intronic
1022419733 7:30209308-30209330 CAGTGGCTCGAGAGTCAGGTGGG - Intergenic
1022446571 7:30475630-30475652 CAATGGCTCCAGAGACAGGGAGG + Intronic
1023835315 7:44064317-44064339 GAGGGGCTCCAGAGGGAGATAGG + Intronic
1024867361 7:53919468-53919490 CAGTGGGTCAAGATGGAGGCAGG - Intergenic
1027246532 7:76371339-76371361 CAGAGGATGCAGAGGAAGGTAGG + Intergenic
1030231043 7:107208773-107208795 CAGTGGCTCATGTGGGATGTGGG + Intronic
1031946781 7:127850473-127850495 CAGTGGCTCTGCCGGGAGGTAGG + Intronic
1032753145 7:134862912-134862934 CAGTGCCTTCAGAGGGAGCCTGG - Intronic
1032796810 7:135284146-135284168 AAGTGGCAACAGATGGAGGTGGG - Intergenic
1034012682 7:147547030-147547052 CAGTGGCTGCAGTAAGAGGTGGG + Intronic
1034587336 7:152106338-152106360 CAGTGGCTCCACAGGGGGAGTGG - Intronic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1038701846 8:29856256-29856278 CAGAGCCTCCAGAGGGAGCACGG + Intergenic
1038863376 8:31412193-31412215 CAGGGGGTCTAGGGGGAGGTGGG + Intergenic
1039328628 8:36512541-36512563 TAGAGGCTCCAGAGGGAGCACGG + Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1043891146 8:85654193-85654215 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043892222 8:85661030-85661052 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043893341 8:85716310-85716332 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896024 8:85737759-85737781 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896655 8:85744049-85744071 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043898978 8:85762416-85762438 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043900589 8:85774610-85774632 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043902553 8:85789885-85789907 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043904163 8:85802078-85802100 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043905775 8:85814272-85814294 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043907383 8:85826459-85826481 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1044122807 8:88418685-88418707 TAGTGACTTCAGAGGGAGGATGG + Intergenic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1048787364 8:138064181-138064203 CAGTGGCTGCAGAAGGGGCTGGG - Intergenic
1049058876 8:140260283-140260305 CCGTGGCTCGAGAGTGAAGTGGG + Intronic
1049683165 8:143928822-143928844 CAGCGGCTGCTGAGTGAGGTGGG - Intronic
1049698804 8:143997264-143997286 AAGTGGGTCCAGAGGGTGGAGGG - Intronic
1050431780 9:5569470-5569492 CAGTGGGTTGAGAGAGAGGTTGG - Intronic
1053930290 9:43110040-43110062 CAGTGGCTCCCGTGGGATGGTGG + Intergenic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1057171415 9:92965426-92965448 CAGTGGCCCCAGAGCCGGGTGGG + Intronic
1058657912 9:107241581-107241603 CAGTGACTCCTGTGGGAGCTGGG - Intergenic
1059503420 9:114776399-114776421 AAGTGGCTGCAGGGGGAAGTGGG + Intergenic
1059503426 9:114776431-114776453 AAGTGGCTGCAGAGGGAAGTGGG + Intergenic
1060200373 9:121648928-121648950 CAGGGGCGCCGGCGGGAGGTGGG + Intronic
1060376621 9:123120341-123120363 CAGTGCCTCCTGAGAGAGGGTGG - Intronic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1061458572 9:130717558-130717580 CTTTGGCTCCAGTGGGAGCTTGG - Intronic
1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG + Intergenic
1061487680 9:130928640-130928662 CAGTGGCTGCTGGGGGCGGTGGG + Intronic
1061792950 9:133068154-133068176 CAGTGGCTGCTGAGGCAGGCGGG - Intronic
1061795556 9:133083938-133083960 CAGTGGCTGCTGAGGCAGGCGGG - Intronic
1062315427 9:135964845-135964867 CTGTGGCTCCAGAGGGAGCGTGG - Intergenic
1062392963 9:136341272-136341294 CGAGGGCTCCAGGGGGAGGTGGG - Intronic
1062570940 9:137185068-137185090 CAGTGGATCGAGCGGGTGGTCGG - Exonic
1185593499 X:1293789-1293811 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593520 X:1293875-1293897 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1185593549 X:1294005-1294027 CACTGGGTCCAGGTGGAGGTGGG - Intronic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1189215518 X:39319767-39319789 CTTTGGCTCCAGATGGAGGGTGG + Intergenic
1189362237 X:40361872-40361894 CAGTGGCTGCAGGAGGAAGTGGG + Intergenic
1190428396 X:50354164-50354186 GAGTGGCTACAGAGGTAAGTAGG + Intergenic
1191130520 X:57003563-57003585 CAGAGGCTACAAAGGGAAGTGGG - Intergenic
1193312808 X:80026898-80026920 AAATGGCTCCAGAGGGACCTTGG + Intronic
1193986410 X:88246172-88246194 CAGTGGGTCTAGTGGGAGGGTGG - Intergenic
1194876956 X:99201183-99201205 CTGTGGCTTCAGAGGGTGGAAGG + Intergenic
1195081855 X:101378712-101378734 CTGTTGCTCCATAGGGAGCTGGG - Intronic
1195474147 X:105264837-105264859 CATTGTCTCTAGAGGGATGTTGG + Intronic
1195951920 X:110284173-110284195 AAATGGCTCCAGAGGCAGGAGGG + Intronic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1198012058 X:132567246-132567268 AAGTAGCTGCAGAGGCAGGTGGG + Intergenic
1200100182 X:153686285-153686307 CAGAGGCTCGAGAAGGATGTAGG - Intronic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic