ID: 913239300

View in Genome Browser
Species Human (GRCh38)
Location 1:116815407-116815429
Sequence GTGCAGAAATAGAACTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913239300_913239302 1 Left 913239300 1:116815407-116815429 CCCTTCTAGTTCTATTTCTGCAC No data
Right 913239302 1:116815431-116815453 TCCGTGTTTTAACACAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913239300 Original CRISPR GTGCAGAAATAGAACTAGAA GGG (reversed) Intergenic
No off target data available for this crispr