ID: 913241703

View in Genome Browser
Species Human (GRCh38)
Location 1:116835485-116835507
Sequence CTCTGCCAGTGGCAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913241699_913241703 -10 Left 913241699 1:116835472-116835494 CCTTGCCTGACAACTCTGCCAGT No data
Right 913241703 1:116835485-116835507 CTCTGCCAGTGGCAAATGGCAGG No data
913241694_913241703 30 Left 913241694 1:116835432-116835454 CCTAAAGTCAGGAATCATGCAGG No data
Right 913241703 1:116835485-116835507 CTCTGCCAGTGGCAAATGGCAGG No data
913241697_913241703 3 Left 913241697 1:116835459-116835481 CCACAGGTTTAGCCCTTGCCTGA No data
Right 913241703 1:116835485-116835507 CTCTGCCAGTGGCAAATGGCAGG No data
913241698_913241703 -9 Left 913241698 1:116835471-116835493 CCCTTGCCTGACAACTCTGCCAG No data
Right 913241703 1:116835485-116835507 CTCTGCCAGTGGCAAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913241703 Original CRISPR CTCTGCCAGTGGCAAATGGC AGG Intergenic
No off target data available for this crispr