ID: 913243625

View in Genome Browser
Species Human (GRCh38)
Location 1:116852250-116852272
Sequence CCTGAAAAGCAGACTCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913243622_913243625 -1 Left 913243622 1:116852228-116852250 CCATATTGACGCAGTCAGGGTCC No data
Right 913243625 1:116852250-116852272 CCTGAAAAGCAGACTCTGAAAGG No data
913243616_913243625 24 Left 913243616 1:116852203-116852225 CCTGCTCTAATCAGGCTTCAGGG No data
Right 913243625 1:116852250-116852272 CCTGAAAAGCAGACTCTGAAAGG No data
913243621_913243625 0 Left 913243621 1:116852227-116852249 CCCATATTGACGCAGTCAGGGTC No data
Right 913243625 1:116852250-116852272 CCTGAAAAGCAGACTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913243625 Original CRISPR CCTGAAAAGCAGACTCTGAA AGG Intergenic
No off target data available for this crispr