ID: 913243650

View in Genome Browser
Species Human (GRCh38)
Location 1:116852433-116852455
Sequence CCAGTTCAGGACATCTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913243650_913243663 30 Left 913243650 1:116852433-116852455 CCTTTAGAGATGTCCTGAACTGG No data
Right 913243663 1:116852486-116852508 GTTAATCAGGGGCAAACCTTGGG No data
913243650_913243659 18 Left 913243650 1:116852433-116852455 CCTTTAGAGATGTCCTGAACTGG No data
Right 913243659 1:116852474-116852496 TGATACCTCTGTGTTAATCAGGG No data
913243650_913243662 29 Left 913243650 1:116852433-116852455 CCTTTAGAGATGTCCTGAACTGG No data
Right 913243662 1:116852485-116852507 TGTTAATCAGGGGCAAACCTTGG No data
913243650_913243660 19 Left 913243650 1:116852433-116852455 CCTTTAGAGATGTCCTGAACTGG No data
Right 913243660 1:116852475-116852497 GATACCTCTGTGTTAATCAGGGG No data
913243650_913243658 17 Left 913243650 1:116852433-116852455 CCTTTAGAGATGTCCTGAACTGG No data
Right 913243658 1:116852473-116852495 CTGATACCTCTGTGTTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913243650 Original CRISPR CCAGTTCAGGACATCTCTAA AGG (reversed) Intergenic
No off target data available for this crispr