ID: 913243673

View in Genome Browser
Species Human (GRCh38)
Location 1:116852538-116852560
Sequence CTGCAGAGATTGACAACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913243668_913243673 13 Left 913243668 1:116852502-116852524 CCTTGGGTGGGGTGACTCTCGGC No data
Right 913243673 1:116852538-116852560 CTGCAGAGATTGACAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913243673 Original CRISPR CTGCAGAGATTGACAACTGA AGG Intergenic
No off target data available for this crispr