ID: 913243673 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:116852538-116852560 |
Sequence | CTGCAGAGATTGACAACTGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
913243668_913243673 | 13 | Left | 913243668 | 1:116852502-116852524 | CCTTGGGTGGGGTGACTCTCGGC | No data | ||
Right | 913243673 | 1:116852538-116852560 | CTGCAGAGATTGACAACTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
913243673 | Original CRISPR | CTGCAGAGATTGACAACTGA AGG | Intergenic | ||
No off target data available for this crispr |