ID: 913244542

View in Genome Browser
Species Human (GRCh38)
Location 1:116860108-116860130
Sequence AGCAATAATCTGAATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913244542_913244545 -1 Left 913244542 1:116860108-116860130 CCTACCTCATTCAGATTATTGCT No data
Right 913244545 1:116860130-116860152 TTTTTTTTTTTTTTGGATGAAGG No data
913244542_913244544 -8 Left 913244542 1:116860108-116860130 CCTACCTCATTCAGATTATTGCT No data
Right 913244544 1:116860123-116860145 TTATTGCTTTTTTTTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913244542 Original CRISPR AGCAATAATCTGAATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr