ID: 913249538

View in Genome Browser
Species Human (GRCh38)
Location 1:116901117-116901139
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913249538_913249549 22 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249549 1:116901162-116901184 AGGATGGGCTAGGGGCAGGAAGG No data
913249538_913249543 6 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249543 1:116901146-116901168 CAAACGCTGCAGCACAAGGATGG No data
913249538_913249547 14 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249547 1:116901154-116901176 GCAGCACAAGGATGGGCTAGGGG No data
913249538_913249544 7 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249544 1:116901147-116901169 AAACGCTGCAGCACAAGGATGGG No data
913249538_913249545 12 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249545 1:116901152-116901174 CTGCAGCACAAGGATGGGCTAGG 0: 1
1: 0
2: 0
3: 21
4: 262
913249538_913249546 13 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249546 1:116901153-116901175 TGCAGCACAAGGATGGGCTAGGG No data
913249538_913249541 2 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249541 1:116901142-116901164 GTGCCAAACGCTGCAGCACAAGG No data
913249538_913249548 18 Left 913249538 1:116901117-116901139 CCCTGGCATTCTGTATGCCACAC No data
Right 913249548 1:116901158-116901180 CACAAGGATGGGCTAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913249538 Original CRISPR GTGTGGCATACAGAATGCCA GGG (reversed) Intergenic